Incidental Mutation 'R1547:Snap25'
ID 172243
Institutional Source Beutler Lab
Gene Symbol Snap25
Ensembl Gene ENSMUSG00000027273
Gene Name synaptosomal-associated protein 25
Synonyms Bdr, sp, SNAP-25, GENA 70
MMRRC Submission 039586-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1547 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 136555373-136624348 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 136619389 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 181 (I181F)
Ref Sequence ENSEMBL: ENSMUSP00000105725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028727] [ENSMUST00000110098]
AlphaFold P60879
Predicted Effect possibly damaging
Transcript: ENSMUST00000028727
AA Change: I181F

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000028727
Gene: ENSMUSG00000027273
AA Change: I181F

DomainStartEndE-ValueType
t_SNARE 14 81 1.93e-12 SMART
t_SNARE 135 202 4.93e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000110098
AA Change: I181F

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105725
Gene: ENSMUSG00000027273
AA Change: I181F

DomainStartEndE-ValueType
t_SNARE 14 81 9.51e-12 SMART
t_SNARE 135 202 4.93e-19 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Synaptic vesicle membrane docking and fusion is mediated by SNAREs (soluble N-ethylmaleimide-sensitive factor attachment protein receptors) located on the vesicle membrane (v-SNAREs) and the target membrane (t-SNAREs). The assembled v-SNARE/t-SNARE complex consists of a bundle of four helices, one of which is supplied by v-SNARE and the other three by t-SNARE. For t-SNAREs on the plasma membrane, the protein syntaxin supplies one helix and the protein encoded by this gene contributes the other two. Therefore, this gene product is a presynaptic plasma membrane protein involved in the regulation of neurotransmitter release. Two alternative transcript variants encoding different protein isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation are small size, blotchy in appearance, have dilated vascular channels, and brain defects, lack spontaneous or reflexive movement and evoked neurotransmitter release at E18.5, and die at birth. An ENU-induced mutant displays neurological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam17 A C 12: 21,403,958 (GRCm39) V96G probably damaging Het
Adam5 G T 8: 25,300,729 (GRCm39) Q267K probably benign Het
Adamts6 A G 13: 104,581,383 (GRCm39) T833A probably benign Het
Ago4 C T 4: 126,405,206 (GRCm39) E456K probably benign Het
Anapc1 T C 2: 128,459,476 (GRCm39) Q1861R probably benign Het
Apob A T 12: 8,053,368 (GRCm39) D1270V probably benign Het
Arb2a T C 13: 77,973,509 (GRCm39) probably null Het
Arhgef11 T A 3: 87,602,709 (GRCm39) I196N possibly damaging Het
Armh4 A T 14: 50,010,953 (GRCm39) D251E probably benign Het
Capzb G A 4: 138,989,409 (GRCm39) probably null Het
Ccdc183 T A 2: 25,499,362 (GRCm39) T466S probably benign Het
Cd101 T C 3: 100,926,267 (GRCm39) T151A possibly damaging Het
Cdc42bpa A T 1: 179,902,209 (GRCm39) I489F probably damaging Het
Cetn4 T C 3: 37,363,600 (GRCm39) K52R possibly damaging Het
Dock6 C T 9: 21,725,884 (GRCm39) E1440K probably damaging Het
Edem2 A G 2: 155,564,436 (GRCm39) F94L probably damaging Het
Elp1 C A 4: 56,792,090 (GRCm39) R226L probably damaging Het
Elp1 C T 4: 56,798,810 (GRCm39) V51M probably damaging Het
Entrep1 T C 19: 23,957,065 (GRCm39) D315G probably damaging Het
Etl4 T C 2: 20,790,039 (GRCm39) S881P probably damaging Het
Fat2 G A 11: 55,143,081 (GRCm39) P4256L probably benign Het
Fmnl2 A G 2: 52,995,549 (GRCm39) E424G probably damaging Het
Kif19a A G 11: 114,677,398 (GRCm39) E594G probably benign Het
Kifap3 A G 1: 163,621,655 (GRCm39) D101G probably benign Het
Klhl6 T C 16: 19,784,832 (GRCm39) D102G probably benign Het
Klra3 G C 6: 130,310,107 (GRCm39) R138G probably benign Het
Lamb2 A G 9: 108,359,824 (GRCm39) H388R probably benign Het
Lmna T C 3: 88,389,658 (GRCm39) S656G probably benign Het
Map3k12 T A 15: 102,412,287 (GRCm39) I285F probably damaging Het
Map3k7 A G 4: 31,991,796 (GRCm39) I345V probably benign Het
Mcph1 A G 8: 18,672,702 (GRCm39) R111G possibly damaging Het
Mfsd6l T A 11: 68,447,434 (GRCm39) V95D probably damaging Het
Mogs T A 6: 83,093,006 (GRCm39) M118K possibly damaging Het
Npy5r T C 8: 67,133,686 (GRCm39) E369G possibly damaging Het
Nudt16l2 A T 9: 105,021,889 (GRCm39) F52L probably damaging Het
Or10j3 T A 1: 173,031,239 (GRCm39) Y105* probably null Het
Or2t49 A G 11: 58,392,651 (GRCm39) S244P probably damaging Het
Or8b12b A C 9: 37,683,960 (GRCm39) T2P probably benign Het
Pde7b C A 10: 20,310,340 (GRCm39) L207F probably damaging Het
Pigo A G 4: 43,020,689 (GRCm39) V751A probably benign Het
Polr2a T C 11: 69,625,381 (GRCm39) Y1923C probably benign Het
Prokr2 T C 2: 132,215,522 (GRCm39) Y152C probably damaging Het
Rab40c A G 17: 26,102,724 (GRCm39) S223P probably damaging Het
Recql4 A C 15: 76,590,511 (GRCm39) C658G probably damaging Het
Sgca T C 11: 94,860,259 (GRCm39) T46A probably damaging Het
Slc39a4 G T 15: 76,498,347 (GRCm39) C363* probably null Het
Snx32 T A 19: 5,547,339 (GRCm39) Q256L possibly damaging Het
Soat1 A G 1: 156,267,331 (GRCm39) V284A probably damaging Het
Sox6 G A 7: 115,300,957 (GRCm39) T170M possibly damaging Het
Spag16 G T 1: 69,912,402 (GRCm39) V246F possibly damaging Het
St6galnac6 T C 2: 32,504,977 (GRCm39) V141A possibly damaging Het
Sult2a7 T A 7: 14,211,047 (GRCm39) probably null Het
Syngr3 A T 17: 24,906,698 (GRCm39) V39E probably damaging Het
Tango6 A G 8: 107,508,418 (GRCm39) T917A probably damaging Het
Tas1r1 A G 4: 152,112,876 (GRCm39) S726P probably damaging Het
Zeb1 C T 18: 5,767,450 (GRCm39) R654C possibly damaging Het
Other mutations in Snap25
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0281:Snap25 UTSW 2 136,619,384 (GRCm39) missense probably damaging 0.99
R1257:Snap25 UTSW 2 136,600,268 (GRCm39) missense probably damaging 1.00
R1880:Snap25 UTSW 2 136,619,305 (GRCm39) missense probably damaging 1.00
R2030:Snap25 UTSW 2 136,611,973 (GRCm39) intron probably benign
R4808:Snap25 UTSW 2 136,612,022 (GRCm39) missense probably damaging 1.00
R6968:Snap25 UTSW 2 136,611,690 (GRCm39) missense probably benign 0.40
R8132:Snap25 UTSW 2 136,611,748 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCTGTGTGTATTCTTCCCACAAGC -3'
(R):5'- TGTTCTAAGTGCCTAGCACATGCC -3'

Sequencing Primer
(F):5'- CAAGCTCTACCCCTTGGTAAC -3'
(R):5'- gctcaatacccagcactcac -3'
Posted On 2014-04-13