Incidental Mutation 'R1547:Arhgef11'
ID172248
Institutional Source Beutler Lab
Gene Symbol Arhgef11
Ensembl Gene ENSMUSG00000041977
Gene NameRho guanine nucleotide exchange factor (GEF) 11
SynonymsPrg, PDZ-RhoGEF
MMRRC Submission 039586-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1547 (G1)
Quality Score110
Status Not validated
Chromosome3
Chromosomal Location87617559-87738034 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87695402 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 196 (I196N)
Ref Sequence ENSEMBL: ENSMUSP00000039900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039476] [ENSMUST00000129113] [ENSMUST00000152006]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039476
AA Change: I196N

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000039900
Gene: ENSMUSG00000041977
AA Change: I196N

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
PDZ 55 123 2.45e-18 SMART
low complexity region 149 160 N/A INTRINSIC
coiled coil region 205 231 N/A INTRINSIC
RGS 353 472 3.36e-11 SMART
low complexity region 554 565 N/A INTRINSIC
low complexity region 625 639 N/A INTRINSIC
low complexity region 681 694 N/A INTRINSIC
RhoGEF 768 952 1.11e-65 SMART
PH 996 1111 9.49e-6 SMART
low complexity region 1153 1166 N/A INTRINSIC
low complexity region 1176 1188 N/A INTRINSIC
low complexity region 1333 1343 N/A INTRINSIC
low complexity region 1357 1367 N/A INTRINSIC
low complexity region 1478 1490 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129113
SMART Domains Protein: ENSMUSP00000118123
Gene: ENSMUSG00000041977

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
PDZ 55 123 2.45e-18 SMART
low complexity region 149 160 N/A INTRINSIC
RGS 313 432 3.36e-11 SMART
low complexity region 596 610 N/A INTRINSIC
low complexity region 652 665 N/A INTRINSIC
RhoGEF 739 923 1.11e-65 SMART
PH 967 1082 9.49e-6 SMART
low complexity region 1124 1137 N/A INTRINSIC
low complexity region 1147 1159 N/A INTRINSIC
low complexity region 1304 1314 N/A INTRINSIC
low complexity region 1328 1338 N/A INTRINSIC
low complexity region 1449 1461 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136072
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142799
Predicted Effect possibly damaging
Transcript: ENSMUST00000152006
AA Change: I196N

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000122166
Gene: ENSMUSG00000041977
AA Change: I196N

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
PDZ 55 123 2.45e-18 SMART
low complexity region 149 160 N/A INTRINSIC
coiled coil region 205 231 N/A INTRINSIC
RGS 353 472 3.36e-11 SMART
low complexity region 554 565 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. A similar protein in rat interacts with glutamate transporter EAAT4 and modulates its glutamate transport activity. Expression of the rat protein induces the reorganization of the actin cytoskeleton and its overexpression induces the formation of membrane ruffling and filopodia. Two alternative transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no obvious phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik A T 9: 105,144,690 F52L probably damaging Het
3632451O06Rik A T 14: 49,773,496 D251E probably benign Het
Adam17 A C 12: 21,353,957 V96G probably damaging Het
Adam5 G T 8: 24,810,713 Q267K probably benign Het
Adamts6 A G 13: 104,444,875 T833A probably benign Het
Ago4 C T 4: 126,511,413 E456K probably benign Het
Anapc1 T C 2: 128,617,556 Q1861R probably benign Het
Apob A T 12: 8,003,368 D1270V probably benign Het
Capzb G A 4: 139,262,098 probably null Het
Ccdc183 T A 2: 25,609,350 T466S probably benign Het
Cd101 T C 3: 101,018,951 T151A possibly damaging Het
Cdc42bpa A T 1: 180,074,644 I489F probably damaging Het
Cetn4 T C 3: 37,309,451 K52R possibly damaging Het
Dock6 C T 9: 21,814,588 E1440K probably damaging Het
Edem2 A G 2: 155,722,516 F94L probably damaging Het
Etl4 T C 2: 20,785,228 S881P probably damaging Het
Fam172a T C 13: 77,825,390 probably null Het
Fam189a2 T C 19: 23,979,701 D315G probably damaging Het
Fat2 G A 11: 55,252,255 P4256L probably benign Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Ikbkap C A 4: 56,792,090 R226L probably damaging Het
Ikbkap C T 4: 56,798,810 V51M probably damaging Het
Kif19a A G 11: 114,786,572 E594G probably benign Het
Kifap3 A G 1: 163,794,086 D101G probably benign Het
Klhl6 T C 16: 19,966,082 D102G probably benign Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Lamb2 A G 9: 108,482,625 H388R probably benign Het
Lmna T C 3: 88,482,351 S656G probably benign Het
Map3k12 T A 15: 102,503,852 I285F probably damaging Het
Map3k7 A G 4: 31,991,796 I345V probably benign Het
Mcph1 A G 8: 18,622,686 R111G possibly damaging Het
Mfsd6l T A 11: 68,556,608 V95D probably damaging Het
Mogs T A 6: 83,116,025 M118K possibly damaging Het
Npy5r T C 8: 66,681,034 E369G possibly damaging Het
Olfr218 T A 1: 173,203,672 Y105* probably null Het
Olfr331 A G 11: 58,501,825 S244P probably damaging Het
Olfr875 A C 9: 37,772,664 T2P probably benign Het
Pde7b C A 10: 20,434,594 L207F probably damaging Het
Pigo A G 4: 43,020,689 V751A probably benign Het
Polr2a T C 11: 69,734,555 Y1923C probably benign Het
Prokr2 T C 2: 132,373,602 Y152C probably damaging Het
Rab40c A G 17: 25,883,750 S223P probably damaging Het
Recql4 A C 15: 76,706,311 C658G probably damaging Het
Sgca T C 11: 94,969,433 T46A probably damaging Het
Slc39a4 G T 15: 76,614,147 C363* probably null Het
Snap25 A T 2: 136,777,469 I181F possibly damaging Het
Snx32 T A 19: 5,497,311 Q256L possibly damaging Het
Soat1 A G 1: 156,439,761 V284A probably damaging Het
Sox6 G A 7: 115,701,722 T170M possibly damaging Het
Spag16 G T 1: 69,873,243 V246F possibly damaging Het
St6galnac6 T C 2: 32,614,965 V141A possibly damaging Het
Sult2a7 T A 7: 14,477,122 probably null Het
Syngr3 A T 17: 24,687,724 V39E probably damaging Het
Tango6 A G 8: 106,781,786 T917A probably damaging Het
Tas1r1 A G 4: 152,028,419 S726P probably damaging Het
Zeb1 C T 18: 5,767,450 R654C possibly damaging Het
Other mutations in Arhgef11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Arhgef11 APN 3 87729503 missense probably damaging 1.00
IGL00900:Arhgef11 APN 3 87683560 missense possibly damaging 0.71
IGL01291:Arhgef11 APN 3 87733174 missense probably benign 0.00
IGL01475:Arhgef11 APN 3 87727126 splice site probably benign
IGL01599:Arhgef11 APN 3 87737046 missense probably benign
IGL02251:Arhgef11 APN 3 87683547 missense probably damaging 1.00
IGL02651:Arhgef11 APN 3 87698864 missense probably damaging 0.99
IGL02884:Arhgef11 APN 3 87728006 missense probably damaging 1.00
IGL02900:Arhgef11 APN 3 87733160 missense probably benign 0.07
IGL03017:Arhgef11 APN 3 87717060 nonsense probably null
ANU05:Arhgef11 UTSW 3 87733174 missense probably benign 0.00
R0049:Arhgef11 UTSW 3 87729193 splice site probably null
R0049:Arhgef11 UTSW 3 87729193 splice site probably null
R0129:Arhgef11 UTSW 3 87728063 missense probably damaging 1.00
R0486:Arhgef11 UTSW 3 87688852 unclassified probably null
R0698:Arhgef11 UTSW 3 87733459 missense probably benign 0.24
R0701:Arhgef11 UTSW 3 87733459 missense probably benign 0.24
R0849:Arhgef11 UTSW 3 87735896 missense probably benign 0.24
R1055:Arhgef11 UTSW 3 87717118 missense probably benign 0.19
R1256:Arhgef11 UTSW 3 87727135 missense possibly damaging 0.81
R1401:Arhgef11 UTSW 3 87733469 nonsense probably null
R1543:Arhgef11 UTSW 3 87713017 missense probably benign 0.10
R1564:Arhgef11 UTSW 3 87702510 missense probably benign
R1675:Arhgef11 UTSW 3 87731211 missense possibly damaging 0.84
R2082:Arhgef11 UTSW 3 87725996 missense possibly damaging 0.47
R2293:Arhgef11 UTSW 3 87727990 missense probably damaging 1.00
R4739:Arhgef11 UTSW 3 87697999 missense possibly damaging 0.47
R4930:Arhgef11 UTSW 3 87728594 missense probably damaging 1.00
R5130:Arhgef11 UTSW 3 87726014 missense possibly damaging 0.71
R5151:Arhgef11 UTSW 3 87735360 missense probably damaging 1.00
R5157:Arhgef11 UTSW 3 87728510 splice site probably null
R5203:Arhgef11 UTSW 3 87735357 missense probably damaging 1.00
R5329:Arhgef11 UTSW 3 87679752 intron probably benign
R5615:Arhgef11 UTSW 3 87722485 critical splice donor site probably null
R5646:Arhgef11 UTSW 3 87684486 missense possibly damaging 0.94
R6125:Arhgef11 UTSW 3 87729602 missense probably damaging 1.00
R6242:Arhgef11 UTSW 3 87728078 missense probably benign
R6543:Arhgef11 UTSW 3 87733408 missense probably benign 0.09
R6801:Arhgef11 UTSW 3 87735852 missense possibly damaging 0.53
R6939:Arhgef11 UTSW 3 87686920 missense probably damaging 1.00
R7008:Arhgef11 UTSW 3 87729218 missense possibly damaging 0.92
R7155:Arhgef11 UTSW 3 87709572 nonsense probably null
R7169:Arhgef11 UTSW 3 87727448 missense possibly damaging 0.79
R7325:Arhgef11 UTSW 3 87713292 missense possibly damaging 0.62
R7392:Arhgef11 UTSW 3 87717175 critical splice donor site probably null
R7683:Arhgef11 UTSW 3 87722383 missense probably damaging 0.98
R7875:Arhgef11 UTSW 3 87684501 missense probably damaging 1.00
R7912:Arhgef11 UTSW 3 87733222 missense probably damaging 1.00
R8028:Arhgef11 UTSW 3 87735552 missense probably benign
R8081:Arhgef11 UTSW 3 87725642 missense probably damaging 1.00
R8118:Arhgef11 UTSW 3 87735857 missense probably damaging 1.00
R8207:Arhgef11 UTSW 3 87698775 missense possibly damaging 0.71
R8290:Arhgef11 UTSW 3 87725968 missense probably damaging 1.00
X0011:Arhgef11 UTSW 3 87722406 missense probably benign
Z1176:Arhgef11 UTSW 3 87735462 missense not run
Predicted Primers PCR Primer
(F):5'- CCTAAATGACGGTGGAATAGCAGGC -3'
(R):5'- CCAGATGAATGGTGAGTGACACCAG -3'

Sequencing Primer
(F):5'- TAGCAGGCAGGCATCTATAAC -3'
(R):5'- GCATGAAGCAGGCTTTGATATCC -3'
Posted On2014-04-13