Incidental Mutation 'R1547:Dock6'
ID172270
Institutional Source Beutler Lab
Gene Symbol Dock6
Ensembl Gene ENSMUSG00000032198
Gene Namededicator of cytokinesis 6
Synonyms2410095B20Rik, C330023D02Rik, 4931431C02Rik
MMRRC Submission 039586-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.369) question?
Stock #R1547 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location21799860-21852635 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 21814588 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 1440 (E1440K)
Ref Sequence ENSEMBL: ENSMUSP00000034728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034728] [ENSMUST00000217336]
Predicted Effect probably damaging
Transcript: ENSMUST00000034728
AA Change: E1440K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034728
Gene: ENSMUSG00000032198
AA Change: E1440K

DomainStartEndE-ValueType
low complexity region 26 42 N/A INTRINSIC
Pfam:DUF3398 63 155 4.7e-26 PFAM
low complexity region 419 429 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
Pfam:DOCK-C2 542 721 3.4e-46 PFAM
low complexity region 754 770 N/A INTRINSIC
low complexity region 776 787 N/A INTRINSIC
low complexity region 945 965 N/A INTRINSIC
low complexity region 1057 1072 N/A INTRINSIC
low complexity region 1123 1153 N/A INTRINSIC
low complexity region 1173 1190 N/A INTRINSIC
low complexity region 1340 1356 N/A INTRINSIC
Pfam:DHR-2 1554 2080 6.6e-214 PFAM
low complexity region 2093 2107 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184374
Predicted Effect unknown
Transcript: ENSMUST00000215729
AA Change: E204K
Predicted Effect probably damaging
Transcript: ENSMUST00000217336
AA Change: E1471K

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis (DOCK) family of atypical guanine nucleotide exchange factors. Guanine nucleotide exchange factors interact with small GTPases and are components of intracellular signaling networks. The encoded protein is a group C DOCK protein and plays a role in actin cytoskeletal reorganization by activating the Rho GTPases Cdc42 and Rac1. Mutations in this gene are associated with Adams-Oliver syndrome 2. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik A T 9: 105,144,690 F52L probably damaging Het
3632451O06Rik A T 14: 49,773,496 D251E probably benign Het
Adam17 A C 12: 21,353,957 V96G probably damaging Het
Adam5 G T 8: 24,810,713 Q267K probably benign Het
Adamts6 A G 13: 104,444,875 T833A probably benign Het
Ago4 C T 4: 126,511,413 E456K probably benign Het
Anapc1 T C 2: 128,617,556 Q1861R probably benign Het
Apob A T 12: 8,003,368 D1270V probably benign Het
Arhgef11 T A 3: 87,695,402 I196N possibly damaging Het
Capzb G A 4: 139,262,098 probably null Het
Ccdc183 T A 2: 25,609,350 T466S probably benign Het
Cd101 T C 3: 101,018,951 T151A possibly damaging Het
Cdc42bpa A T 1: 180,074,644 I489F probably damaging Het
Cetn4 T C 3: 37,309,451 K52R possibly damaging Het
Edem2 A G 2: 155,722,516 F94L probably damaging Het
Etl4 T C 2: 20,785,228 S881P probably damaging Het
Fam172a T C 13: 77,825,390 probably null Het
Fam189a2 T C 19: 23,979,701 D315G probably damaging Het
Fat2 G A 11: 55,252,255 P4256L probably benign Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Ikbkap C A 4: 56,792,090 R226L probably damaging Het
Ikbkap C T 4: 56,798,810 V51M probably damaging Het
Kif19a A G 11: 114,786,572 E594G probably benign Het
Kifap3 A G 1: 163,794,086 D101G probably benign Het
Klhl6 T C 16: 19,966,082 D102G probably benign Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Lamb2 A G 9: 108,482,625 H388R probably benign Het
Lmna T C 3: 88,482,351 S656G probably benign Het
Map3k12 T A 15: 102,503,852 I285F probably damaging Het
Map3k7 A G 4: 31,991,796 I345V probably benign Het
Mcph1 A G 8: 18,622,686 R111G possibly damaging Het
Mfsd6l T A 11: 68,556,608 V95D probably damaging Het
Mogs T A 6: 83,116,025 M118K possibly damaging Het
Npy5r T C 8: 66,681,034 E369G possibly damaging Het
Olfr218 T A 1: 173,203,672 Y105* probably null Het
Olfr331 A G 11: 58,501,825 S244P probably damaging Het
Olfr875 A C 9: 37,772,664 T2P probably benign Het
Pde7b C A 10: 20,434,594 L207F probably damaging Het
Pigo A G 4: 43,020,689 V751A probably benign Het
Polr2a T C 11: 69,734,555 Y1923C probably benign Het
Prokr2 T C 2: 132,373,602 Y152C probably damaging Het
Rab40c A G 17: 25,883,750 S223P probably damaging Het
Recql4 A C 15: 76,706,311 C658G probably damaging Het
Sgca T C 11: 94,969,433 T46A probably damaging Het
Slc39a4 G T 15: 76,614,147 C363* probably null Het
Snap25 A T 2: 136,777,469 I181F possibly damaging Het
Snx32 T A 19: 5,497,311 Q256L possibly damaging Het
Soat1 A G 1: 156,439,761 V284A probably damaging Het
Sox6 G A 7: 115,701,722 T170M possibly damaging Het
Spag16 G T 1: 69,873,243 V246F possibly damaging Het
St6galnac6 T C 2: 32,614,965 V141A possibly damaging Het
Sult2a7 T A 7: 14,477,122 probably null Het
Syngr3 A T 17: 24,687,724 V39E probably damaging Het
Tango6 A G 8: 106,781,786 T917A probably damaging Het
Tas1r1 A G 4: 152,028,419 S726P probably damaging Het
Zeb1 C T 18: 5,767,450 R654C possibly damaging Het
Other mutations in Dock6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Dock6 APN 9 21846634 missense possibly damaging 0.50
IGL01025:Dock6 APN 9 21811807 missense possibly damaging 0.89
IGL01390:Dock6 APN 9 21803045 missense probably damaging 1.00
IGL02025:Dock6 APN 9 21809589 missense probably damaging 0.98
IGL02028:Dock6 APN 9 21838826 missense probably damaging 1.00
IGL02311:Dock6 APN 9 21844328 missense probably damaging 1.00
IGL02441:Dock6 APN 9 21841926 missense possibly damaging 0.77
IGL02504:Dock6 APN 9 21846655 missense probably benign 0.19
IGL02516:Dock6 APN 9 21802585 missense probably damaging 1.00
IGL02836:Dock6 APN 9 21801864 missense probably damaging 1.00
IGL02894:Dock6 APN 9 21811815 missense probably damaging 1.00
bayfront UTSW 9 21821745 missense probably benign 0.29
IGL03048:Dock6 UTSW 9 21809570 missense probably damaging 1.00
R0370:Dock6 UTSW 9 21814565 missense probably benign 0.29
R0504:Dock6 UTSW 9 21802436 missense probably damaging 1.00
R0633:Dock6 UTSW 9 21844417 missense probably benign 0.00
R0634:Dock6 UTSW 9 21841527 missense probably damaging 1.00
R0671:Dock6 UTSW 9 21804627 splice site probably benign
R0839:Dock6 UTSW 9 21817892 missense probably benign 0.01
R0948:Dock6 UTSW 9 21801533 missense probably damaging 1.00
R1022:Dock6 UTSW 9 21833612 missense probably damaging 1.00
R1024:Dock6 UTSW 9 21833612 missense probably damaging 1.00
R1073:Dock6 UTSW 9 21846518 missense probably benign
R1463:Dock6 UTSW 9 21831906 missense probably damaging 1.00
R1481:Dock6 UTSW 9 21820622 missense probably benign
R1494:Dock6 UTSW 9 21814742 missense probably benign 0.34
R1654:Dock6 UTSW 9 21804843 missense probably damaging 0.98
R1782:Dock6 UTSW 9 21811846 missense probably damaging 1.00
R1905:Dock6 UTSW 9 21829574 missense probably benign 0.37
R1908:Dock6 UTSW 9 21841629 missense probably damaging 1.00
R1916:Dock6 UTSW 9 21813091 missense probably damaging 1.00
R2132:Dock6 UTSW 9 21846518 missense probably benign
R2197:Dock6 UTSW 9 21832881 missense probably damaging 1.00
R2316:Dock6 UTSW 9 21839677 missense probably damaging 0.98
R2341:Dock6 UTSW 9 21839486 splice site probably benign
R2519:Dock6 UTSW 9 21816333 missense possibly damaging 0.54
R2924:Dock6 UTSW 9 21809630 missense probably damaging 1.00
R2939:Dock6 UTSW 9 21839200 missense possibly damaging 0.88
R2940:Dock6 UTSW 9 21839200 missense possibly damaging 0.88
R3078:Dock6 UTSW 9 21845754 splice site probably benign
R3081:Dock6 UTSW 9 21839200 missense possibly damaging 0.88
R3810:Dock6 UTSW 9 21801577 missense probably damaging 1.00
R4246:Dock6 UTSW 9 21839490 splice site probably null
R4604:Dock6 UTSW 9 21802540 missense probably damaging 1.00
R4833:Dock6 UTSW 9 21844280 missense probably damaging 1.00
R4849:Dock6 UTSW 9 21811772 critical splice donor site probably null
R4896:Dock6 UTSW 9 21824437 missense possibly damaging 0.48
R4926:Dock6 UTSW 9 21845791 missense probably damaging 1.00
R5183:Dock6 UTSW 9 21841603 missense probably benign 0.00
R5211:Dock6 UTSW 9 21820352 missense probably benign 0.36
R5337:Dock6 UTSW 9 21829548 missense possibly damaging 0.93
R5353:Dock6 UTSW 9 21814786 missense probably benign 0.00
R5429:Dock6 UTSW 9 21832881 missense probably damaging 0.99
R5463:Dock6 UTSW 9 21809958 intron probably null
R5476:Dock6 UTSW 9 21809589 missense probably damaging 0.98
R5511:Dock6 UTSW 9 21817407 missense possibly damaging 0.59
R5534:Dock6 UTSW 9 21803076 nonsense probably null
R5718:Dock6 UTSW 9 21824493 missense probably benign 0.11
R5823:Dock6 UTSW 9 21804828 missense probably damaging 0.99
R5831:Dock6 UTSW 9 21803036 missense probably damaging 1.00
R5887:Dock6 UTSW 9 21820394 missense probably damaging 0.96
R5930:Dock6 UTSW 9 21824416 missense probably benign 0.29
R6159:Dock6 UTSW 9 21821745 missense probably benign 0.29
R6633:Dock6 UTSW 9 21820331 missense probably benign 0.17
R6633:Dock6 UTSW 9 21821503 missense probably damaging 1.00
R6665:Dock6 UTSW 9 21839912 missense probably damaging 0.99
R6744:Dock6 UTSW 9 21831474 missense probably damaging 1.00
R6903:Dock6 UTSW 9 21809564 missense probably damaging 1.00
R6981:Dock6 UTSW 9 21845550 missense probably damaging 0.99
R7024:Dock6 UTSW 9 21820370 missense probably benign
R7030:Dock6 UTSW 9 21813079 missense probably damaging 1.00
R7045:Dock6 UTSW 9 21821811 missense probably damaging 1.00
R7139:Dock6 UTSW 9 21801276 missense probably damaging 1.00
R7356:Dock6 UTSW 9 21809899 missense probably damaging 1.00
R7400:Dock6 UTSW 9 21801807 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- AGCCAACGTCATCTCTGTGAAGC -3'
(R):5'- GAGAGCATTCATTCCTCTGTGCCC -3'

Sequencing Primer
(F):5'- TCATCTCTGTGAAGCACGGC -3'
(R):5'- AGTGACATCACGAGCTGTCC -3'
Posted On2014-04-13