Incidental Mutation 'R1547:Kif19a'
ID172282
Institutional Source Beutler Lab
Gene Symbol Kif19a
Ensembl Gene ENSMUSG00000010021
Gene Namekinesin family member 19A
SynonymsN-8 kinesin
MMRRC Submission 039586-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R1547 (G1)
Quality Score121
Status Not validated
Chromosome11
Chromosomal Location114765388-114790739 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 114786572 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 594 (E594G)
Ref Sequence ENSEMBL: ENSMUSP00000081398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000206] [ENSMUST00000084368] [ENSMUST00000138804]
Predicted Effect probably benign
Transcript: ENSMUST00000000206
SMART Domains Protein: ENSMUSP00000000206
Gene: ENSMUSG00000000202

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 49 59 N/A INTRINSIC
BTB 63 162 2.01e-11 SMART
BACK 169 269 8.58e-19 SMART
Blast:BACK 425 460 1e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000084368
AA Change: E594G

PolyPhen 2 Score 0.405 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000081398
Gene: ENSMUSG00000010021
AA Change: E594G

DomainStartEndE-ValueType
KISc 9 354 4.53e-150 SMART
coiled coil region 361 388 N/A INTRINSIC
coiled coil region 431 449 N/A INTRINSIC
coiled coil region 506 551 N/A INTRINSIC
low complexity region 628 641 N/A INTRINSIC
low complexity region 750 766 N/A INTRINSIC
low complexity region 807 815 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126555
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131782
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134165
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137326
Predicted Effect probably benign
Transcript: ENSMUST00000138340
SMART Domains Protein: ENSMUSP00000122743
Gene: ENSMUSG00000010021

DomainStartEndE-ValueType
low complexity region 22 38 N/A INTRINSIC
low complexity region 79 87 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138804
AA Change: E552G

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000115663
Gene: ENSMUSG00000010021
AA Change: E552G

DomainStartEndE-ValueType
KISc 9 312 2.99e-118 SMART
coiled coil region 319 346 N/A INTRINSIC
coiled coil region 389 407 N/A INTRINSIC
coiled coil region 464 509 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
low complexity region 683 692 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156053
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156192
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display partial postnatal lethality, hydroencephaly, female infertility, oviduct obstruction, increased motile cilium length and impaired motile cilium movement. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik A T 9: 105,144,690 F52L probably damaging Het
3632451O06Rik A T 14: 49,773,496 D251E probably benign Het
Adam17 A C 12: 21,353,957 V96G probably damaging Het
Adam5 G T 8: 24,810,713 Q267K probably benign Het
Adamts6 A G 13: 104,444,875 T833A probably benign Het
Ago4 C T 4: 126,511,413 E456K probably benign Het
Anapc1 T C 2: 128,617,556 Q1861R probably benign Het
Apob A T 12: 8,003,368 D1270V probably benign Het
Arhgef11 T A 3: 87,695,402 I196N possibly damaging Het
Capzb G A 4: 139,262,098 probably null Het
Ccdc183 T A 2: 25,609,350 T466S probably benign Het
Cd101 T C 3: 101,018,951 T151A possibly damaging Het
Cdc42bpa A T 1: 180,074,644 I489F probably damaging Het
Cetn4 T C 3: 37,309,451 K52R possibly damaging Het
Dock6 C T 9: 21,814,588 E1440K probably damaging Het
Edem2 A G 2: 155,722,516 F94L probably damaging Het
Etl4 T C 2: 20,785,228 S881P probably damaging Het
Fam172a T C 13: 77,825,390 probably null Het
Fam189a2 T C 19: 23,979,701 D315G probably damaging Het
Fat2 G A 11: 55,252,255 P4256L probably benign Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Ikbkap C A 4: 56,792,090 R226L probably damaging Het
Ikbkap C T 4: 56,798,810 V51M probably damaging Het
Kifap3 A G 1: 163,794,086 D101G probably benign Het
Klhl6 T C 16: 19,966,082 D102G probably benign Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Lamb2 A G 9: 108,482,625 H388R probably benign Het
Lmna T C 3: 88,482,351 S656G probably benign Het
Map3k12 T A 15: 102,503,852 I285F probably damaging Het
Map3k7 A G 4: 31,991,796 I345V probably benign Het
Mcph1 A G 8: 18,622,686 R111G possibly damaging Het
Mfsd6l T A 11: 68,556,608 V95D probably damaging Het
Mogs T A 6: 83,116,025 M118K possibly damaging Het
Npy5r T C 8: 66,681,034 E369G possibly damaging Het
Olfr218 T A 1: 173,203,672 Y105* probably null Het
Olfr331 A G 11: 58,501,825 S244P probably damaging Het
Olfr875 A C 9: 37,772,664 T2P probably benign Het
Pde7b C A 10: 20,434,594 L207F probably damaging Het
Pigo A G 4: 43,020,689 V751A probably benign Het
Polr2a T C 11: 69,734,555 Y1923C probably benign Het
Prokr2 T C 2: 132,373,602 Y152C probably damaging Het
Rab40c A G 17: 25,883,750 S223P probably damaging Het
Recql4 A C 15: 76,706,311 C658G probably damaging Het
Sgca T C 11: 94,969,433 T46A probably damaging Het
Slc39a4 G T 15: 76,614,147 C363* probably null Het
Snap25 A T 2: 136,777,469 I181F possibly damaging Het
Snx32 T A 19: 5,497,311 Q256L possibly damaging Het
Soat1 A G 1: 156,439,761 V284A probably damaging Het
Sox6 G A 7: 115,701,722 T170M possibly damaging Het
Spag16 G T 1: 69,873,243 V246F possibly damaging Het
St6galnac6 T C 2: 32,614,965 V141A possibly damaging Het
Sult2a7 T A 7: 14,477,122 probably null Het
Syngr3 A T 17: 24,687,724 V39E probably damaging Het
Tango6 A G 8: 106,781,786 T917A probably damaging Het
Tas1r1 A G 4: 152,028,419 S726P probably damaging Het
Zeb1 C T 18: 5,767,450 R654C possibly damaging Het
Other mutations in Kif19a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Kif19a APN 11 114779585 missense probably damaging 1.00
IGL00743:Kif19a APN 11 114784773 missense probably damaging 1.00
IGL00763:Kif19a APN 11 114767168 missense probably benign 0.00
IGL01327:Kif19a APN 11 114781799 splice site probably benign
IGL02422:Kif19a APN 11 114789361 missense probably damaging 1.00
IGL02481:Kif19a APN 11 114789153 missense probably benign 0.28
IGL02496:Kif19a APN 11 114779644 missense probably damaging 0.99
IGL02735:Kif19a APN 11 114785567 missense probably damaging 1.00
IGL02830:Kif19a APN 11 114781208 missense probably damaging 1.00
IGL02902:Kif19a APN 11 114785570 missense possibly damaging 0.46
IGL03372:Kif19a APN 11 114779218 missense probably damaging 0.99
PIT4520001:Kif19a UTSW 11 114781208 missense probably damaging 1.00
R0212:Kif19a UTSW 11 114784910 missense possibly damaging 0.48
R0383:Kif19a UTSW 11 114765514 start codon destroyed possibly damaging 0.63
R0850:Kif19a UTSW 11 114780787 missense probably damaging 0.99
R1343:Kif19a UTSW 11 114785827 missense probably benign 0.08
R1422:Kif19a UTSW 11 114785809 missense probably benign 0.01
R1591:Kif19a UTSW 11 114789231 missense probably benign
R2148:Kif19a UTSW 11 114780768 missense probably damaging 1.00
R2291:Kif19a UTSW 11 114790193 missense probably damaging 1.00
R3814:Kif19a UTSW 11 114781919 missense probably damaging 1.00
R3944:Kif19a UTSW 11 114786735 missense probably benign 0.34
R4631:Kif19a UTSW 11 114784847 missense possibly damaging 0.95
R4866:Kif19a UTSW 11 114767227 missense probably benign 0.00
R4867:Kif19a UTSW 11 114767227 missense probably benign 0.00
R5022:Kif19a UTSW 11 114767227 missense probably benign 0.00
R5071:Kif19a UTSW 11 114767227 missense probably benign 0.00
R5072:Kif19a UTSW 11 114767227 missense probably benign 0.00
R5073:Kif19a UTSW 11 114767227 missense probably benign 0.00
R5074:Kif19a UTSW 11 114767227 missense probably benign 0.00
R5091:Kif19a UTSW 11 114783097 missense probably damaging 1.00
R5640:Kif19a UTSW 11 114779215 missense probably benign 0.25
R5646:Kif19a UTSW 11 114779654 missense probably damaging 1.00
R5786:Kif19a UTSW 11 114779223 nonsense probably null
R5890:Kif19a UTSW 11 114789438 missense possibly damaging 0.92
R6344:Kif19a UTSW 11 114781951 critical splice donor site probably null
R6522:Kif19a UTSW 11 114785779 missense probably damaging 1.00
R6570:Kif19a UTSW 11 114784905 missense possibly damaging 0.63
R6879:Kif19a UTSW 11 114781333 missense probably benign 0.03
R7028:Kif19a UTSW 11 114781208 missense probably damaging 1.00
R7274:Kif19a UTSW 11 114765455 start gained probably benign
R7492:Kif19a UTSW 11 114790239 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- GTCACAGGGCATGGTTGAGTCAAG -3'
(R):5'- AGACTTCGTAGAGTTCCTCCAGGTG -3'

Sequencing Primer
(F):5'- GGGCTAACCTATACTTGGAGTACC -3'
(R):5'- CGGGGAACCTCCAGATTGTAG -3'
Posted On2014-04-13