Incidental Mutation 'R1547:Adam17'
ID172284
Institutional Source Beutler Lab
Gene Symbol Adam17
Ensembl Gene ENSMUSG00000052593
Gene Namea disintegrin and metallopeptidase domain 17
SynonymsCD156b, Tace
MMRRC Submission 039586-MU
Accession Numbers

Genbank: NM_009615; MGI: 1096335

Is this an essential gene? Probably essential (E-score: 0.912) question?
Stock #R1547 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location21323509-21373632 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 21353957 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 96 (V96G)
Ref Sequence ENSEMBL: ENSMUSP00000155990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064536] [ENSMUST00000101551] [ENSMUST00000127974] [ENSMUST00000142092] [ENSMUST00000145118] [ENSMUST00000232107] [ENSMUST00000232526]
Predicted Effect probably benign
Transcript: ENSMUST00000064536
AA Change: V96G

PolyPhen 2 Score 0.192 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000067953
Gene: ENSMUSG00000052593
AA Change: V96G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 28 167 1.1e-11 PFAM
Pfam:Reprolysin_5 221 451 6.7e-37 PFAM
Pfam:Reprolysin_4 221 469 3.2e-24 PFAM
Pfam:Reprolysin_2 244 464 8.8e-29 PFAM
Pfam:Reprolysin_3 248 416 1.2e-12 PFAM
Pfam:Reprolysin 383 474 3.1e-9 PFAM
DISIN 484 561 6.27e-26 SMART
PDB:2M2F|A 581 642 4e-32 PDB
transmembrane domain 672 694 N/A INTRINSIC
low complexity region 739 755 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101551
AA Change: V96G

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000099087
Gene: ENSMUSG00000052593
AA Change: V96G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 167 9.7e-15 PFAM
Pfam:Reprolysin_5 221 470 5e-34 PFAM
Pfam:Reprolysin_4 221 488 6.1e-20 PFAM
Pfam:Reprolysin_2 264 483 2.6e-34 PFAM
Pfam:Reprolysin_3 267 435 2.8e-14 PFAM
Pfam:Reprolysin 330 493 5.3e-9 PFAM
DISIN 503 580 6.27e-26 SMART
Pfam:ADAM17_MPD 600 661 1e-23 PFAM
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 758 774 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000127974
AA Change: V96G

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000136677
Gene: ENSMUSG00000052593
AA Change: V96G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 25 167 9.1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142092
SMART Domains Protein: ENSMUSP00000136255
Gene: ENSMUSG00000052593

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 35 47 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145118
AA Change: V96G

PolyPhen 2 Score 0.192 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000136407
Gene: ENSMUSG00000052593
AA Change: V96G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 28 167 7.5e-12 PFAM
Pfam:Reprolysin_5 221 451 4.2e-37 PFAM
Pfam:Reprolysin_4 221 469 2e-24 PFAM
Pfam:Reprolysin_2 244 464 5.6e-29 PFAM
Pfam:Reprolysin_3 248 416 7.8e-13 PFAM
Pfam:Reprolysin 381 474 2.2e-9 PFAM
DISIN 484 561 6.27e-26 SMART
PDB:2M2F|A 581 638 5e-29 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158372
Predicted Effect probably damaging
Transcript: ENSMUST00000232107
AA Change: V96G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000232526
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature enzyme that is involved in the proteolytic release of membrane-bound proteins in a process called ectodomain shedding. Mice lacking the encoded protein die in utero or fail to survive beyond one week of age. Alternative splicing results in multiple transcript variants encoding different isoforms, some of which may undergo similar processing. [provided by RefSeq, May 2016]
PHENOTYPE: Most mice homozygous for targeted mutations that inactivate the gene die perinatally with stunted vibrissae and open eyelids. Survivors display various degrees of eye degeneration, perturbed hair coats, curly vibrissae, and irregular pigmentation patterns. Histological analysis of fetuses reveal defects in epithelial cell maturation and organization in multiple organs. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted, knock-out(2) Targeted, other(3) Gene trapped(8)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik A T 9: 105,144,690 F52L probably damaging Het
3632451O06Rik A T 14: 49,773,496 D251E probably benign Het
Adam5 G T 8: 24,810,713 Q267K probably benign Het
Adamts6 A G 13: 104,444,875 T833A probably benign Het
Ago4 C T 4: 126,511,413 E456K probably benign Het
Anapc1 T C 2: 128,617,556 Q1861R probably benign Het
Apob A T 12: 8,003,368 D1270V probably benign Het
Arhgef11 T A 3: 87,695,402 I196N possibly damaging Het
Capzb G A 4: 139,262,098 probably null Het
Ccdc183 T A 2: 25,609,350 T466S probably benign Het
Cd101 T C 3: 101,018,951 T151A possibly damaging Het
Cdc42bpa A T 1: 180,074,644 I489F probably damaging Het
Cetn4 T C 3: 37,309,451 K52R possibly damaging Het
Dock6 C T 9: 21,814,588 E1440K probably damaging Het
Edem2 A G 2: 155,722,516 F94L probably damaging Het
Etl4 T C 2: 20,785,228 S881P probably damaging Het
Fam172a T C 13: 77,825,390 probably null Het
Fam189a2 T C 19: 23,979,701 D315G probably damaging Het
Fat2 G A 11: 55,252,255 P4256L probably benign Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Ikbkap C A 4: 56,792,090 R226L probably damaging Het
Ikbkap C T 4: 56,798,810 V51M probably damaging Het
Kif19a A G 11: 114,786,572 E594G probably benign Het
Kifap3 A G 1: 163,794,086 D101G probably benign Het
Klhl6 T C 16: 19,966,082 D102G probably benign Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Lamb2 A G 9: 108,482,625 H388R probably benign Het
Lmna T C 3: 88,482,351 S656G probably benign Het
Map3k12 T A 15: 102,503,852 I285F probably damaging Het
Map3k7 A G 4: 31,991,796 I345V probably benign Het
Mcph1 A G 8: 18,622,686 R111G possibly damaging Het
Mfsd6l T A 11: 68,556,608 V95D probably damaging Het
Mogs T A 6: 83,116,025 M118K possibly damaging Het
Npy5r T C 8: 66,681,034 E369G possibly damaging Het
Olfr218 T A 1: 173,203,672 Y105* probably null Het
Olfr331 A G 11: 58,501,825 S244P probably damaging Het
Olfr875 A C 9: 37,772,664 T2P probably benign Het
Pde7b C A 10: 20,434,594 L207F probably damaging Het
Pigo A G 4: 43,020,689 V751A probably benign Het
Polr2a T C 11: 69,734,555 Y1923C probably benign Het
Prokr2 T C 2: 132,373,602 Y152C probably damaging Het
Rab40c A G 17: 25,883,750 S223P probably damaging Het
Recql4 A C 15: 76,706,311 C658G probably damaging Het
Sgca T C 11: 94,969,433 T46A probably damaging Het
Slc39a4 G T 15: 76,614,147 C363* probably null Het
Snap25 A T 2: 136,777,469 I181F possibly damaging Het
Snx32 T A 19: 5,497,311 Q256L possibly damaging Het
Soat1 A G 1: 156,439,761 V284A probably damaging Het
Sox6 G A 7: 115,701,722 T170M possibly damaging Het
Spag16 G T 1: 69,873,243 V246F possibly damaging Het
St6galnac6 T C 2: 32,614,965 V141A possibly damaging Het
Sult2a7 T A 7: 14,477,122 probably null Het
Syngr3 A T 17: 24,687,724 V39E probably damaging Het
Tango6 A G 8: 106,781,786 T917A probably damaging Het
Tas1r1 A G 4: 152,028,419 S726P probably damaging Het
Zeb1 C T 18: 5,767,450 R654C possibly damaging Het
Other mutations in Adam17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00555:Adam17 APN 12 21328109 missense probably damaging 1.00
IGL01340:Adam17 APN 12 21330057 nonsense probably null
IGL01973:Adam17 APN 12 21349943 missense probably damaging 1.00
IGL02223:Adam17 APN 12 21361705 missense possibly damaging 0.92
IGL03153:Adam17 APN 12 21345697 missense probably damaging 1.00
Steinway UTSW 12 21353948 missense probably damaging 1.00
wavedx UTSW 12 21340750 missense probably damaging 1.00
R0014:Adam17 UTSW 12 21336644 missense probably benign 0.36
R0080:Adam17 UTSW 12 21329048 splice site probably benign
R0082:Adam17 UTSW 12 21329048 splice site probably benign
R0324:Adam17 UTSW 12 21349938 missense probably benign 0.00
R0511:Adam17 UTSW 12 21340458 splice site probably benign
R0745:Adam17 UTSW 12 21332221 splice site probably benign
R1314:Adam17 UTSW 12 21329071 missense probably damaging 1.00
R1594:Adam17 UTSW 12 21340470 critical splice donor site probably null
R1607:Adam17 UTSW 12 21334138 intron probably null
R1812:Adam17 UTSW 12 21361767 missense probably damaging 0.97
R2020:Adam17 UTSW 12 21349875 missense probably damaging 1.00
R3408:Adam17 UTSW 12 21329118 missense probably damaging 1.00
R3735:Adam17 UTSW 12 21325412 missense probably benign 0.05
R3886:Adam17 UTSW 12 21325587 missense probably damaging 1.00
R3888:Adam17 UTSW 12 21325587 missense probably damaging 1.00
R4062:Adam17 UTSW 12 21325457 missense probably damaging 1.00
R4415:Adam17 UTSW 12 21345701 missense possibly damaging 0.90
R4563:Adam17 UTSW 12 21332088 missense probably damaging 1.00
R4658:Adam17 UTSW 12 21332160 missense probably damaging 1.00
R4763:Adam17 UTSW 12 21334015 missense probably benign
R4793:Adam17 UTSW 12 21347395 missense probably benign
R5101:Adam17 UTSW 12 21373405 missense possibly damaging 0.85
R5120:Adam17 UTSW 12 21343019 intron probably benign
R5514:Adam17 UTSW 12 21340519 missense probably damaging 0.98
R5592:Adam17 UTSW 12 21334137 missense probably damaging 1.00
R5874:Adam17 UTSW 12 21329086 missense possibly damaging 0.76
R6110:Adam17 UTSW 12 21353948 missense probably damaging 1.00
R6451:Adam17 UTSW 12 21342882 missense probably benign 0.00
R6930:Adam17 UTSW 12 21353948 missense probably damaging 1.00
R6970:Adam17 UTSW 12 21345668 missense probably benign 0.06
R7213:Adam17 UTSW 12 21336678 nonsense probably null
R7302:Adam17 UTSW 12 21355693 intron probably benign
R7361:Adam17 UTSW 12 21325601 missense probably damaging 0.98
R7667:Adam17 UTSW 12 21333952 critical splice donor site probably null
R7799:Adam17 UTSW 12 21340492 missense probably damaging 1.00
X0063:Adam17 UTSW 12 21332585 missense probably benign 0.17
Z1176:Adam17 UTSW 12 21361737 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ACTCACTGACATAAATCCTCTTGCCTCT -3'
(R):5'- tGCCTCCCACTTtttgtttgtttgttt -3'

Sequencing Primer
(F):5'- TGTTTATGCCAGGTTTTCCATCATTG -3'
(R):5'- gccaatcttctctgtgtcgtc -3'
Posted On2014-04-13