Incidental Mutation 'R1547:Rab40c'
ID172294
Institutional Source Beutler Lab
Gene Symbol Rab40c
Ensembl Gene ENSMUSG00000025730
Gene NameRab40C, member RAS oncogene family
SynonymsRAR3
MMRRC Submission 039586-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.250) question?
Stock #R1547 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location25882114-25919727 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25883750 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 223 (S223P)
Ref Sequence ENSEMBL: ENSMUSP00000127868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026826] [ENSMUST00000095487] [ENSMUST00000163356] [ENSMUST00000164738] [ENSMUST00000164982] [ENSMUST00000166146] [ENSMUST00000167018] [ENSMUST00000167626] [ENSMUST00000176696] [ENSMUST00000179998]
Predicted Effect probably damaging
Transcript: ENSMUST00000026826
AA Change: S242P

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000026826
Gene: ENSMUSG00000025730
AA Change: S242P

DomainStartEndE-ValueType
RAB 15 177 9.2e-77 SMART
SOCS 183 226 1.6e-18 SMART
SOCS_box 189 225 7.2e-10 SMART
low complexity region 238 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095487
SMART Domains Protein: ENSMUSP00000093141
Gene: ENSMUSG00000071192

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
WAP 32 82 4.04e-3 SMART
KAZAL 119 161 1.96e-2 SMART
IGc2 202 274 2.54e-14 SMART
KU 301 356 4.2e-3 SMART
KU 361 414 1.82e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163356
SMART Domains Protein: ENSMUSP00000130209
Gene: ENSMUSG00000025731

DomainStartEndE-ValueType
Pfam:DUF938 1 172 1.6e-74 PFAM
Pfam:Methyltransf_25 31 133 9e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164738
SMART Domains Protein: ENSMUSP00000130093
Gene: ENSMUSG00000025730

DomainStartEndE-ValueType
Pfam:Arf 5 110 5.2e-7 PFAM
Pfam:Miro 16 111 4.2e-12 PFAM
Pfam:Ras 16 111 2.6e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164982
AA Change: S223P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127868
Gene: ENSMUSG00000025730
AA Change: S223P

DomainStartEndE-ValueType
RAB 15 158 5.56e-54 SMART
SOCS 164 207 2.56e-16 SMART
SOCS_box 170 206 9.29e-6 SMART
low complexity region 219 243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166146
SMART Domains Protein: ENSMUSP00000132355
Gene: ENSMUSG00000025730

DomainStartEndE-ValueType
SCOP:d3raba_ 10 43 3e-9 SMART
Blast:RAB 15 49 1e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166619
Predicted Effect probably damaging
Transcript: ENSMUST00000167018
AA Change: S242P

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131055
Gene: ENSMUSG00000025730
AA Change: S242P

DomainStartEndE-ValueType
RAB 15 177 1.88e-74 SMART
SOCS 183 226 2.56e-16 SMART
SOCS_box 189 225 9.29e-6 SMART
low complexity region 238 262 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167626
AA Change: S242P

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127546
Gene: ENSMUSG00000025730
AA Change: S242P

DomainStartEndE-ValueType
RAB 15 177 9.2e-77 SMART
SOCS 183 226 1.6e-18 SMART
SOCS_box 189 225 7.2e-10 SMART
low complexity region 238 262 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172168
Predicted Effect probably benign
Transcript: ENSMUST00000176696
SMART Domains Protein: ENSMUSP00000135083
Gene: ENSMUSG00000071192

DomainStartEndE-ValueType
WAP 2 48 8.8e-2 SMART
KAZAL 85 127 1.96e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000179998
AA Change: S242P

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136612
Gene: ENSMUSG00000025730
AA Change: S242P

DomainStartEndE-ValueType
RAB 15 177 9.4e-77 SMART
SOCS 183 226 1.7e-18 SMART
SOCS_box 189 225 7.3e-10 SMART
low complexity region 238 262 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180868
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik A T 9: 105,144,690 F52L probably damaging Het
3632451O06Rik A T 14: 49,773,496 D251E probably benign Het
Adam17 A C 12: 21,353,957 V96G probably damaging Het
Adam5 G T 8: 24,810,713 Q267K probably benign Het
Adamts6 A G 13: 104,444,875 T833A probably benign Het
Ago4 C T 4: 126,511,413 E456K probably benign Het
Anapc1 T C 2: 128,617,556 Q1861R probably benign Het
Apob A T 12: 8,003,368 D1270V probably benign Het
Arhgef11 T A 3: 87,695,402 I196N possibly damaging Het
Capzb G A 4: 139,262,098 probably null Het
Ccdc183 T A 2: 25,609,350 T466S probably benign Het
Cd101 T C 3: 101,018,951 T151A possibly damaging Het
Cdc42bpa A T 1: 180,074,644 I489F probably damaging Het
Cetn4 T C 3: 37,309,451 K52R possibly damaging Het
Dock6 C T 9: 21,814,588 E1440K probably damaging Het
Edem2 A G 2: 155,722,516 F94L probably damaging Het
Etl4 T C 2: 20,785,228 S881P probably damaging Het
Fam172a T C 13: 77,825,390 probably null Het
Fam189a2 T C 19: 23,979,701 D315G probably damaging Het
Fat2 G A 11: 55,252,255 P4256L probably benign Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Ikbkap C A 4: 56,792,090 R226L probably damaging Het
Ikbkap C T 4: 56,798,810 V51M probably damaging Het
Kif19a A G 11: 114,786,572 E594G probably benign Het
Kifap3 A G 1: 163,794,086 D101G probably benign Het
Klhl6 T C 16: 19,966,082 D102G probably benign Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Lamb2 A G 9: 108,482,625 H388R probably benign Het
Lmna T C 3: 88,482,351 S656G probably benign Het
Map3k12 T A 15: 102,503,852 I285F probably damaging Het
Map3k7 A G 4: 31,991,796 I345V probably benign Het
Mcph1 A G 8: 18,622,686 R111G possibly damaging Het
Mfsd6l T A 11: 68,556,608 V95D probably damaging Het
Mogs T A 6: 83,116,025 M118K possibly damaging Het
Npy5r T C 8: 66,681,034 E369G possibly damaging Het
Olfr218 T A 1: 173,203,672 Y105* probably null Het
Olfr331 A G 11: 58,501,825 S244P probably damaging Het
Olfr875 A C 9: 37,772,664 T2P probably benign Het
Pde7b C A 10: 20,434,594 L207F probably damaging Het
Pigo A G 4: 43,020,689 V751A probably benign Het
Polr2a T C 11: 69,734,555 Y1923C probably benign Het
Prokr2 T C 2: 132,373,602 Y152C probably damaging Het
Recql4 A C 15: 76,706,311 C658G probably damaging Het
Sgca T C 11: 94,969,433 T46A probably damaging Het
Slc39a4 G T 15: 76,614,147 C363* probably null Het
Snap25 A T 2: 136,777,469 I181F possibly damaging Het
Snx32 T A 19: 5,497,311 Q256L possibly damaging Het
Soat1 A G 1: 156,439,761 V284A probably damaging Het
Sox6 G A 7: 115,701,722 T170M possibly damaging Het
Spag16 G T 1: 69,873,243 V246F possibly damaging Het
St6galnac6 T C 2: 32,614,965 V141A possibly damaging Het
Sult2a7 T A 7: 14,477,122 probably null Het
Syngr3 A T 17: 24,687,724 V39E probably damaging Het
Tango6 A G 8: 106,781,786 T917A probably damaging Het
Tas1r1 A G 4: 152,028,419 S726P probably damaging Het
Zeb1 C T 18: 5,767,450 R654C possibly damaging Het
Other mutations in Rab40c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Rab40c APN 17 25885085 missense probably damaging 1.00
IGL01793:Rab40c APN 17 25884622 missense probably damaging 1.00
IGL01936:Rab40c APN 17 25884670 missense probably damaging 0.99
R0089:Rab40c UTSW 17 25885148 missense probably damaging 1.00
R0456:Rab40c UTSW 17 25884657 missense possibly damaging 0.68
R0837:Rab40c UTSW 17 25884693 missense probably damaging 1.00
R5488:Rab40c UTSW 17 25890669 missense probably damaging 0.98
R5955:Rab40c UTSW 17 25884657 missense probably damaging 0.98
R7047:Rab40c UTSW 17 25919484 missense probably damaging 0.98
X0028:Rab40c UTSW 17 25890708 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGCGTAAGCCCCAAGTCTGAACAG -3'
(R):5'- TGGTCAGATAGTGGGCATCCAAGAG -3'

Sequencing Primer
(F):5'- TCTGAACAGGCGGAACCC -3'
(R):5'- ATGCAGCAGCCAGGTTTTAC -3'
Posted On2014-04-13