Incidental Mutation 'R1548:Cacna1s'
ID172301
Institutional Source Beutler Lab
Gene Symbol Cacna1s
Ensembl Gene ENSMUSG00000026407
Gene Namecalcium channel, voltage-dependent, L type, alpha 1S subunit
Synonymssj, mdg, muscle dysgenesis, DHPR alpha1s, Cav1.1, Cchl1a3, fmd
MMRRC Submission 039587-MU
Accession Numbers

Genbank: NM_001081023; MGI: 88294

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1548 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location136052750-136119822 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 136110937 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 1172 (F1172S)
Ref Sequence ENSEMBL: ENSMUSP00000125262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112064] [ENSMUST00000112068] [ENSMUST00000160641] [ENSMUST00000161865]
Predicted Effect probably damaging
Transcript: ENSMUST00000112064
AA Change: F1438S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107695
Gene: ENSMUSG00000026407
AA Change: F1438S

DomainStartEndE-ValueType
Pfam:Ion_trans 50 345 4.3e-68 PFAM
Pfam:Ion_trans 431 672 4.5e-56 PFAM
Pfam:PKD_channel 516 667 1.9e-7 PFAM
low complexity region 675 685 N/A INTRINSIC
low complexity region 740 756 N/A INTRINSIC
Pfam:Ion_trans 798 1076 2.6e-65 PFAM
Pfam:Ion_trans 1117 1392 1.2e-71 PFAM
Pfam:PKD_channel 1126 1387 8.4e-13 PFAM
Pfam:GPHH 1394 1463 2.3e-38 PFAM
Ca_chan_IQ 1515 1548 3.71e-14 SMART
low complexity region 1657 1669 N/A INTRINSIC
Pfam:CAC1F_C 1756 1845 2.8e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112068
AA Change: F1419S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107699
Gene: ENSMUSG00000026407
AA Change: F1419S

DomainStartEndE-ValueType
Pfam:Ion_trans 88 333 9.1e-57 PFAM
PDB:4DEY|B 334 417 1e-20 PDB
Pfam:Ion_trans 466 660 3.7e-46 PFAM
Pfam:PKD_channel 513 667 6.7e-7 PFAM
low complexity region 675 685 N/A INTRINSIC
low complexity region 740 756 N/A INTRINSIC
low complexity region 804 818 N/A INTRINSIC
Pfam:Ion_trans 834 1064 3.9e-53 PFAM
Pfam:Ion_trans 1152 1361 6.7e-66 PFAM
Pfam:PKD_channel 1201 1368 8.4e-10 PFAM
Blast:EFh 1382 1410 5e-8 BLAST
Ca_chan_IQ 1496 1529 3.71e-14 SMART
low complexity region 1638 1650 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160641
AA Change: F1438S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125278
Gene: ENSMUSG00000026407
AA Change: F1438S

DomainStartEndE-ValueType
Pfam:Ion_trans 88 333 9.3e-57 PFAM
PDB:4DEY|B 334 417 1e-20 PDB
Pfam:Ion_trans 466 660 3.8e-46 PFAM
Pfam:PKD_channel 513 667 6.7e-7 PFAM
low complexity region 675 685 N/A INTRINSIC
low complexity region 740 756 N/A INTRINSIC
low complexity region 804 818 N/A INTRINSIC
Pfam:Ion_trans 834 1064 4e-53 PFAM
Pfam:PKD_channel 1126 1387 6.1e-12 PFAM
Pfam:Ion_trans 1152 1380 9e-65 PFAM
Blast:EFh 1401 1429 5e-8 BLAST
Ca_chan_IQ 1515 1548 3.71e-14 SMART
low complexity region 1657 1669 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161700
Predicted Effect probably damaging
Transcript: ENSMUST00000161865
AA Change: F1172S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125262
Gene: ENSMUSG00000026407
AA Change: F1172S

DomainStartEndE-ValueType
Pfam:Ion_trans 3 98 1.1e-21 PFAM
Pfam:Ion_trans 184 425 3.3e-56 PFAM
Pfam:PKD_channel 267 420 1.8e-7 PFAM
low complexity region 428 438 N/A INTRINSIC
low complexity region 493 509 N/A INTRINSIC
Pfam:Ion_trans 551 829 1.9e-65 PFAM
Pfam:Ion_trans 870 1126 5.4e-72 PFAM
Pfam:PKD_channel 954 1121 7.2e-10 PFAM
Pfam:GPHH 1128 1197 1.8e-38 PFAM
Ca_chan_IQ 1249 1282 3.71e-14 SMART
low complexity region 1391 1403 N/A INTRINSIC
Meta Mutation Damage Score 0.156 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.3%
Validation Efficiency 99% (69/70)
MGI Phenotype Strain: 1856326
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the five subunits of the slowly inactivating L-type voltage-dependent calcium channel in skeletal muscle cells. Mutations in this gene have been associated with hypokalemic periodic paralysis, thyrotoxic periodic paralysis and malignant hyperthermia susceptibility. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show edema and failure of myoblast differentiation by day 13 of embryonic development and die perinatally. All muscles degenerate and additional secondary anomalies of the skeleton, short jaw, and cleft palate are seen. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Spontaneous(1)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610203C20Rik T C 9: 41,581,376 L116P probably damaging Het
A830018L16Rik A T 1: 11,518,594 R78S probably damaging Het
Acad10 G T 5: 121,626,040 probably benign Het
Acad10 G C 5: 121,626,041 probably benign Het
Ang2 C A 14: 51,195,533 E131* probably null Het
Ankfn1 T C 11: 89,526,541 N82D probably damaging Het
Anks1b T C 10: 90,049,985 I181T possibly damaging Het
Bcl2l12 C G 7: 44,992,818 G215R probably damaging Het
Bnc2 A G 4: 84,275,957 Y1044H probably damaging Het
Cct8 A G 16: 87,485,584 I482T probably damaging Het
Cfap74 C T 4: 155,434,045 T580I probably benign Het
Cib1 A T 7: 80,228,414 Y105* probably null Het
Cpa1 G A 6: 30,642,335 G245D probably damaging Het
Csmd3 A G 15: 47,981,975 V801A possibly damaging Het
Ddx10 T C 9: 53,149,561 probably null Het
Ddx4 T C 13: 112,599,997 N613S probably damaging Het
Drd3 A G 16: 43,821,341 D340G probably benign Het
E2f4 A G 8: 105,304,688 *411W probably null Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Foxp1 A T 6: 98,945,420 I450N probably damaging Het
Gm10229 G A 16: 89,015,389 probably benign Het
Gm5771 G T 6: 41,396,011 L72F probably damaging Het
Gm813 A T 16: 58,615,839 D40E probably benign Het
Gpr19 A G 6: 134,870,084 F175S possibly damaging Het
Gpr21 C T 2: 37,518,072 T210M probably damaging Het
Grhl2 C T 15: 37,336,323 A488V probably benign Het
Hif3a T C 7: 17,044,403 T435A probably benign Het
Hoxb4 C T 11: 96,318,899 R44* probably null Het
Ifi47 A G 11: 49,095,871 D155G probably damaging Het
Igdcc4 T C 9: 65,135,227 L142P probably benign Het
Ints6 G A 14: 62,713,692 P296L probably damaging Het
Itga3 A G 11: 95,046,919 probably null Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Lgals12 A T 19: 7,604,312 H50Q probably benign Het
Lrp12 A G 15: 39,872,506 S696P probably damaging Het
Lrp6 G A 6: 134,459,429 T1258I possibly damaging Het
Meis2 C T 2: 116,058,702 D190N probably damaging Het
Mon2 C T 10: 123,036,007 probably benign Het
Muc6 A G 7: 141,652,103 probably benign Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Myo15 A G 11: 60,488,238 H1394R probably damaging Het
Myo5a A T 9: 75,171,746 I929F probably damaging Het
Nek6 T A 2: 38,568,895 Y141N probably damaging Het
Notch4 T A 17: 34,568,422 C319S probably damaging Het
Nwd2 A T 5: 63,800,182 D285V probably benign Het
Olfml1 T C 7: 107,590,375 S216P possibly damaging Het
Pabpc1l G T 2: 164,037,171 V313F possibly damaging Het
Pfkfb2 G T 1: 130,698,083 H453Q probably benign Het
Pigt C T 2: 164,501,519 T305I probably benign Het
Plxnb1 C T 9: 109,100,900 L275F possibly damaging Het
Ppm1d C T 11: 85,339,605 R350C probably damaging Het
Rassf1 C A 9: 107,551,846 P84T probably benign Het
Rgl3 G T 9: 21,980,706 R361S probably benign Het
Rnf213 G A 11: 119,442,707 R2914H probably damaging Het
Ryr2 A T 13: 11,554,549 C4956* probably null Het
Scaper C T 9: 55,816,670 R668H probably damaging Het
Spata6 T C 4: 111,779,006 F165L probably benign Het
Tcirg1 A T 19: 3,896,845 W694R probably benign Het
Tmem245 A T 4: 56,906,233 Y160* probably null Het
Tshr T C 12: 91,534,031 Y279H probably damaging Het
Ttf1 A C 2: 29,065,138 K171N probably damaging Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Xdh A G 17: 73,913,901 V611A probably damaging Het
Zfp142 G T 1: 74,570,104 H1408N probably damaging Het
Other mutations in Cacna1s
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Cacna1s APN 1 136084273 nonsense probably null
IGL00517:Cacna1s APN 1 136087339 missense probably damaging 1.00
IGL01316:Cacna1s APN 1 136118964 missense probably benign 0.01
IGL01348:Cacna1s APN 1 136075152 missense possibly damaging 0.95
IGL01739:Cacna1s APN 1 136097132 critical splice donor site probably null
IGL01773:Cacna1s APN 1 136118753 missense probably benign 0.32
IGL02056:Cacna1s APN 1 136119000 missense probably benign
IGL02262:Cacna1s APN 1 136108129 missense probably damaging 0.98
IGL02324:Cacna1s APN 1 136075176 splice site probably benign
IGL02352:Cacna1s APN 1 136093252 splice site probably benign
IGL02359:Cacna1s APN 1 136093252 splice site probably benign
IGL02370:Cacna1s APN 1 136085347 missense probably damaging 1.00
IGL02377:Cacna1s APN 1 136068994 missense probably damaging 1.00
IGL02474:Cacna1s APN 1 136118380 missense probably benign
IGL02606:Cacna1s APN 1 136079519 missense probably damaging 0.99
IGL02833:Cacna1s APN 1 136071005 missense probably benign 0.03
IGL02974:Cacna1s APN 1 136092617 missense possibly damaging 0.78
IGL03064:Cacna1s APN 1 136111993 missense probably damaging 1.00
IGL03093:Cacna1s APN 1 136116064 missense probably benign 0.00
IGL03286:Cacna1s APN 1 136077659 missense probably benign
N/A:Cacna1s UTSW 1 136073509 missense probably benign 0.00
R0030:Cacna1s UTSW 1 136094989 critical splice donor site probably null
R0030:Cacna1s UTSW 1 136094989 critical splice donor site probably null
R0097:Cacna1s UTSW 1 136100622 missense possibly damaging 0.79
R0097:Cacna1s UTSW 1 136100622 missense possibly damaging 0.79
R0240:Cacna1s UTSW 1 136073496 unclassified probably benign
R0255:Cacna1s UTSW 1 136118806 missense possibly damaging 0.93
R0302:Cacna1s UTSW 1 136100604 missense probably benign 0.01
R0319:Cacna1s UTSW 1 136070717 missense probably damaging 0.99
R0411:Cacna1s UTSW 1 136113303 missense probably damaging 1.00
R0413:Cacna1s UTSW 1 136098209 missense probably benign 0.00
R0482:Cacna1s UTSW 1 136113394 missense probably benign
R0491:Cacna1s UTSW 1 136089008 splice site probably benign
R0518:Cacna1s UTSW 1 136076859 missense probably benign
R0717:Cacna1s UTSW 1 136098291 missense probably damaging 1.00
R0725:Cacna1s UTSW 1 136098526 splice site probably benign
R0815:Cacna1s UTSW 1 136112957 missense possibly damaging 0.95
R1384:Cacna1s UTSW 1 136094971 missense probably benign 0.02
R1518:Cacna1s UTSW 1 136098551 missense probably damaging 1.00
R1725:Cacna1s UTSW 1 136098623 missense probably damaging 1.00
R1728:Cacna1s UTSW 1 136118716 missense probably benign
R1729:Cacna1s UTSW 1 136118716 missense probably benign
R1730:Cacna1s UTSW 1 136118716 missense probably benign
R1739:Cacna1s UTSW 1 136118716 missense probably benign
R1762:Cacna1s UTSW 1 136118716 missense probably benign
R1783:Cacna1s UTSW 1 136118716 missense probably benign
R1784:Cacna1s UTSW 1 136118716 missense probably benign
R1785:Cacna1s UTSW 1 136118716 missense probably benign
R1800:Cacna1s UTSW 1 136076854 missense probably benign
R1924:Cacna1s UTSW 1 136089017 splice site probably null
R1969:Cacna1s UTSW 1 136119095 missense probably benign 0.42
R2072:Cacna1s UTSW 1 136079504 missense probably benign
R2380:Cacna1s UTSW 1 136095848 missense probably damaging 1.00
R3110:Cacna1s UTSW 1 136075093 nonsense probably null
R3112:Cacna1s UTSW 1 136075093 nonsense probably null
R3151:Cacna1s UTSW 1 136105794 missense probably damaging 1.00
R3696:Cacna1s UTSW 1 136105814 missense probably damaging 1.00
R3722:Cacna1s UTSW 1 136069042 missense possibly damaging 0.77
R3804:Cacna1s UTSW 1 136107018 missense possibly damaging 0.85
R3813:Cacna1s UTSW 1 136085347 missense probably damaging 1.00
R3905:Cacna1s UTSW 1 136084269 missense probably damaging 0.99
R3907:Cacna1s UTSW 1 136084269 missense probably damaging 0.99
R3909:Cacna1s UTSW 1 136084269 missense probably damaging 0.99
R4170:Cacna1s UTSW 1 136108195 missense probably damaging 1.00
R4329:Cacna1s UTSW 1 136119033 missense probably benign 0.00
R4485:Cacna1s UTSW 1 136076852 missense probably damaging 1.00
R4581:Cacna1s UTSW 1 136070970 unclassified probably null
R4719:Cacna1s UTSW 1 136118652 splice site probably benign
R4816:Cacna1s UTSW 1 136115269 missense possibly damaging 0.89
R4909:Cacna1s UTSW 1 136079604 missense probably damaging 0.99
R4917:Cacna1s UTSW 1 136101564 critical splice donor site probably null
R5296:Cacna1s UTSW 1 136095785 missense probably benign 0.11
R5411:Cacna1s UTSW 1 136105811 missense probably benign 0.09
R5503:Cacna1s UTSW 1 136086742 missense probably damaging 1.00
R5533:Cacna1s UTSW 1 136098375 critical splice donor site probably null
R5714:Cacna1s UTSW 1 136112066 missense probably benign 0.44
R5775:Cacna1s UTSW 1 136108122 missense probably damaging 1.00
R5814:Cacna1s UTSW 1 136107142 missense probably benign 0.31
R5820:Cacna1s UTSW 1 136079604 missense probably damaging 1.00
R5822:Cacna1s UTSW 1 136112078 missense probably damaging 1.00
R5877:Cacna1s UTSW 1 136100667 missense probably damaging 0.99
R5923:Cacna1s UTSW 1 136076822 missense possibly damaging 0.79
R6021:Cacna1s UTSW 1 136106487 missense probably benign 0.15
R6037:Cacna1s UTSW 1 136070967 missense possibly damaging 0.90
R6037:Cacna1s UTSW 1 136070967 missense possibly damaging 0.90
R6056:Cacna1s UTSW 1 136105836 missense probably damaging 1.00
R6143:Cacna1s UTSW 1 136076758 missense probably damaging 0.99
R6222:Cacna1s UTSW 1 136104622 missense probably benign 0.00
R6237:Cacna1s UTSW 1 136105844 missense possibly damaging 0.88
R6274:Cacna1s UTSW 1 136089045 missense probably benign 0.02
R6609:Cacna1s UTSW 1 136113391 missense probably benign 0.30
R6626:Cacna1s UTSW 1 136094965 missense probably damaging 1.00
R6838:Cacna1s UTSW 1 136084437 missense possibly damaging 0.91
R6848:Cacna1s UTSW 1 136092694 missense probably benign 0.01
R6849:Cacna1s UTSW 1 136092694 missense probably benign 0.01
R6850:Cacna1s UTSW 1 136092694 missense probably benign 0.01
R6851:Cacna1s UTSW 1 136092694 missense probably benign 0.01
R6868:Cacna1s UTSW 1 136092694 missense probably benign 0.01
R6879:Cacna1s UTSW 1 136115959 missense probably benign 0.12
R6893:Cacna1s UTSW 1 136077693 missense probably benign 0.05
R7017:Cacna1s UTSW 1 136095858 missense probably damaging 0.99
R7228:Cacna1s UTSW 1 136071059 missense possibly damaging 0.90
R7283:Cacna1s UTSW 1 136073708 missense probably damaging 1.00
R7357:Cacna1s UTSW 1 136071021 missense probably damaging 0.99
R7385:Cacna1s UTSW 1 136092633 missense probably damaging 0.99
R7421:Cacna1s UTSW 1 136086802 missense probably damaging 1.00
R7505:Cacna1s UTSW 1 136085449 nonsense probably null
R7519:Cacna1s UTSW 1 136070756 missense probably damaging 0.99
X0025:Cacna1s UTSW 1 136115970 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTGTTTTGTGCCTACCCCAGAAG -3'
(R):5'- CCAGAGAATGGGAGTTTCAGGCTG -3'

Sequencing Primer
(F):5'- gtgagaagggttggggtg -3'
(R):5'- CTGGATGTGAAGTTGGAGCAG -3'
Posted On2014-04-13