Incidental Mutation 'R1548:Pigt'
ID172308
Institutional Source Beutler Lab
Gene Symbol Pigt
Ensembl Gene ENSMUSG00000017721
Gene Namephosphatidylinositol glycan anchor biosynthesis, class T
Synonyms2510012P17Rik, 4930534E15Rik, NDAP, Ndap7, CGI-06
MMRRC Submission 039587-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.802) question?
Stock #R1548 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location164497520-164508301 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 164501519 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 305 (T305I)
Ref Sequence ENSEMBL: ENSMUSP00000112577 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103101] [ENSMUST00000117066]
Predicted Effect probably benign
Transcript: ENSMUST00000103101
AA Change: T305I

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000099390
Gene: ENSMUSG00000017721
AA Change: T305I

DomainStartEndE-ValueType
Pfam:Gpi16 22 576 4.9e-155 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117066
AA Change: T305I

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000112577
Gene: ENSMUSG00000017721
AA Change: T305I

DomainStartEndE-ValueType
Pfam:Gpi16 11 419 4.9e-90 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131976
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138038
Predicted Effect probably benign
Transcript: ENSMUST00000152522
SMART Domains Protein: ENSMUSP00000115362
Gene: ENSMUSG00000017721

DomainStartEndE-ValueType
Pfam:Gpi16 21 134 2.7e-28 PFAM
Meta Mutation Damage Score 0.01 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.3%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved in glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor is a glycolipid found on many blood cells and serves to anchor proteins to the cell surface. This protein is an essential component of the multisubunit enzyme, GPI transamidase. GPI transamidase mediates GPI anchoring in the endoplasmic reticulum, by catalyzing the transfer of fully assembled GPI units to proteins. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a null mutation do not survive. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610203C20Rik T C 9: 41,581,376 L116P probably damaging Het
A830018L16Rik A T 1: 11,518,594 R78S probably damaging Het
Acad10 G T 5: 121,626,040 probably benign Het
Acad10 G C 5: 121,626,041 probably benign Het
Ang2 C A 14: 51,195,533 E131* probably null Het
Ankfn1 T C 11: 89,526,541 N82D probably damaging Het
Anks1b T C 10: 90,049,985 I181T possibly damaging Het
Bcl2l12 C G 7: 44,992,818 G215R probably damaging Het
Bnc2 A G 4: 84,275,957 Y1044H probably damaging Het
Cacna1s T C 1: 136,110,937 F1172S probably damaging Het
Cct8 A G 16: 87,485,584 I482T probably damaging Het
Cfap74 C T 4: 155,434,045 T580I probably benign Het
Cib1 A T 7: 80,228,414 Y105* probably null Het
Cpa1 G A 6: 30,642,335 G245D probably damaging Het
Csmd3 A G 15: 47,981,975 V801A possibly damaging Het
Ddx10 T C 9: 53,149,561 probably null Het
Ddx4 T C 13: 112,599,997 N613S probably damaging Het
Drd3 A G 16: 43,821,341 D340G probably benign Het
E2f4 A G 8: 105,304,688 *411W probably null Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Foxp1 A T 6: 98,945,420 I450N probably damaging Het
Gm10229 G A 16: 89,015,389 probably benign Het
Gm5771 G T 6: 41,396,011 L72F probably damaging Het
Gm813 A T 16: 58,615,839 D40E probably benign Het
Gpr19 A G 6: 134,870,084 F175S possibly damaging Het
Gpr21 C T 2: 37,518,072 T210M probably damaging Het
Grhl2 C T 15: 37,336,323 A488V probably benign Het
Hif3a T C 7: 17,044,403 T435A probably benign Het
Hoxb4 C T 11: 96,318,899 R44* probably null Het
Ifi47 A G 11: 49,095,871 D155G probably damaging Het
Igdcc4 T C 9: 65,135,227 L142P probably benign Het
Ints6 G A 14: 62,713,692 P296L probably damaging Het
Itga3 A G 11: 95,046,919 probably null Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Lgals12 A T 19: 7,604,312 H50Q probably benign Het
Lrp12 A G 15: 39,872,506 S696P probably damaging Het
Lrp6 G A 6: 134,459,429 T1258I possibly damaging Het
Meis2 C T 2: 116,058,702 D190N probably damaging Het
Mon2 C T 10: 123,036,007 probably benign Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Muc6 A G 7: 141,652,103 probably benign Het
Myo15 A G 11: 60,488,238 H1394R probably damaging Het
Myo5a A T 9: 75,171,746 I929F probably damaging Het
Nek6 T A 2: 38,568,895 Y141N probably damaging Het
Notch4 T A 17: 34,568,422 C319S probably damaging Het
Nwd2 A T 5: 63,800,182 D285V probably benign Het
Olfml1 T C 7: 107,590,375 S216P possibly damaging Het
Pabpc1l G T 2: 164,037,171 V313F possibly damaging Het
Pfkfb2 G T 1: 130,698,083 H453Q probably benign Het
Plxnb1 C T 9: 109,100,900 L275F possibly damaging Het
Ppm1d C T 11: 85,339,605 R350C probably damaging Het
Rassf1 C A 9: 107,551,846 P84T probably benign Het
Rgl3 G T 9: 21,980,706 R361S probably benign Het
Rnf213 G A 11: 119,442,707 R2914H probably damaging Het
Ryr2 A T 13: 11,554,549 C4956* probably null Het
Scaper C T 9: 55,816,670 R668H probably damaging Het
Spata6 T C 4: 111,779,006 F165L probably benign Het
Tcirg1 A T 19: 3,896,845 W694R probably benign Het
Tmem245 A T 4: 56,906,233 Y160* probably null Het
Tshr T C 12: 91,534,031 Y279H probably damaging Het
Ttf1 A C 2: 29,065,138 K171N probably damaging Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Xdh A G 17: 73,913,901 V611A probably damaging Het
Zfp142 G T 1: 74,570,104 H1408N probably damaging Het
Other mutations in Pigt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03076:Pigt APN 2 164497665 missense probably damaging 1.00
R1551:Pigt UTSW 2 164507403 missense probably damaging 0.99
R1605:Pigt UTSW 2 164507499 missense probably damaging 1.00
R3712:Pigt UTSW 2 164501645 missense probably benign 0.00
R3848:Pigt UTSW 2 164498580 critical splice donor site probably benign
R4672:Pigt UTSW 2 164497578 unclassified probably benign
R4719:Pigt UTSW 2 164501624 missense probably damaging 0.98
R5481:Pigt UTSW 2 164506422 missense probably damaging 1.00
R5567:Pigt UTSW 2 164501562 nonsense probably null
R5570:Pigt UTSW 2 164501562 nonsense probably null
R5998:Pigt UTSW 2 164507454 missense possibly damaging 0.82
R6112:Pigt UTSW 2 164506445 nonsense probably null
R6816:Pigt UTSW 2 164501132 missense probably damaging 1.00
R6889:Pigt UTSW 2 164507331 missense probably damaging 1.00
R7019:Pigt UTSW 2 164499669 frame shift probably null
R7037:Pigt UTSW 2 164499669 frame shift probably null
R7197:Pigt UTSW 2 164502516 missense probably damaging 1.00
R7288:Pigt UTSW 2 164499669 frame shift probably null
R7449:Pigt UTSW 2 164502499 missense probably damaging 1.00
R7533:Pigt UTSW 2 164499669 frame shift probably null
R7534:Pigt UTSW 2 164499669 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCTGACTGCATGGACGCACCTATC -3'
(R):5'- CGTATCTGAATCTGCTGCAAACCCC -3'

Sequencing Primer
(F):5'- CTGTCCATTGGCGTCTCAGAG -3'
(R):5'- CACCCCATCAACTCACCATTATC -3'
Posted On2014-04-13