Incidental Mutation 'R1548:Muc6'
ID172331
Institutional Source Beutler Lab
Gene Symbol Muc6
Ensembl Gene ENSMUSG00000048191
Gene Namemucin 6, gastric
Synonyms
MMRRC Submission 039587-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R1548 (G1)
Quality Score156
Status Validated
Chromosome7
Chromosomal Location141633456-141655319 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 141652103 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140483 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062451] [ENSMUST00000189314] [ENSMUST00000190907]
Predicted Effect probably benign
Transcript: ENSMUST00000062451
SMART Domains Protein: ENSMUSP00000049941
Gene: ENSMUSG00000048191

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VWD 29 234 2.49e-14 SMART
C8 267 340 5.46e-3 SMART
Pfam:TIL 344 399 5.6e-14 PFAM
VWC 401 469 2.57e-7 SMART
VWD 428 591 4.81e-30 SMART
C8 627 703 8.84e-21 SMART
SCOP:d1coua_ 706 769 7e-9 SMART
Pfam:TIL 806 869 1.9e-9 PFAM
VWC 871 941 8.52e-3 SMART
VWD 898 1060 1.59e-30 SMART
C8 1096 1170 5.52e-31 SMART
Blast:CT 1184 1236 2e-19 BLAST
low complexity region 1240 1269 N/A INTRINSIC
low complexity region 1275 1293 N/A INTRINSIC
low complexity region 1313 1337 N/A INTRINSIC
low complexity region 1345 1374 N/A INTRINSIC
internal_repeat_3 1375 1560 6.78e-17 PROSPERO
internal_repeat_2 1426 1751 8.94e-34 PROSPERO
low complexity region 1761 1780 N/A INTRINSIC
low complexity region 1867 1887 N/A INTRINSIC
low complexity region 1896 1910 N/A INTRINSIC
low complexity region 1912 1946 N/A INTRINSIC
low complexity region 1990 2004 N/A INTRINSIC
low complexity region 2010 2020 N/A INTRINSIC
internal_repeat_2 2036 2430 8.94e-34 PROSPERO
internal_repeat_3 2329 2516 6.78e-17 PROSPERO
low complexity region 2519 2536 N/A INTRINSIC
low complexity region 2564 2587 N/A INTRINSIC
low complexity region 2605 2630 N/A INTRINSIC
low complexity region 2642 2677 N/A INTRINSIC
low complexity region 2729 2762 N/A INTRINSIC
Blast:CT 2765 2852 1e-44 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000189314
SMART Domains Protein: ENSMUSP00000140388
Gene: ENSMUSG00000048191

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VWD 29 193 2.64e-27 SMART
C8 226 299 5.46e-3 SMART
Pfam:TIL 303 358 1.4e-13 PFAM
VWC 360 428 2.57e-7 SMART
VWD 387 550 4.81e-30 SMART
C8 586 662 8.84e-21 SMART
internal_repeat_2 665 754 5.76e-7 PROSPERO
Pfam:TIL 765 828 6.4e-9 PFAM
VWC 830 900 8.52e-3 SMART
VWD 857 1019 1.59e-30 SMART
C8 1055 1129 5.52e-31 SMART
low complexity region 1199 1228 N/A INTRINSIC
low complexity region 1234 1252 N/A INTRINSIC
low complexity region 1272 1296 N/A INTRINSIC
low complexity region 1304 1333 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190907
SMART Domains Protein: ENSMUSP00000140483
Gene: ENSMUSG00000048191

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VWD 29 234 1.2e-16 SMART
C8 267 340 4.2e-7 SMART
Pfam:TIL 344 399 7.2e-11 PFAM
VWC_def 401 469 1.2e-9 SMART
VWD 428 591 2.4e-32 SMART
C8 627 703 6.7e-25 SMART
SCOP:d1coua_ 706 769 5e-9 SMART
Pfam:TIL 806 869 3.3e-6 PFAM
VWC_def 871 941 4.1e-5 SMART
VWD 898 1060 7.7e-33 SMART
C8 1096 1170 4.2e-35 SMART
Blast:CT 1184 1236 2e-19 BLAST
low complexity region 1240 1269 N/A INTRINSIC
low complexity region 1275 1293 N/A INTRINSIC
low complexity region 1313 1337 N/A INTRINSIC
low complexity region 1345 1374 N/A INTRINSIC
low complexity region 1406 1419 N/A INTRINSIC
internal_repeat_1 1426 1822 3.44e-48 PROSPERO
low complexity region 1826 1845 N/A INTRINSIC
low complexity region 1932 1952 N/A INTRINSIC
low complexity region 1961 1975 N/A INTRINSIC
low complexity region 1977 2011 N/A INTRINSIC
low complexity region 2055 2069 N/A INTRINSIC
low complexity region 2075 2085 N/A INTRINSIC
internal_repeat_1 2101 2501 3.44e-48 PROSPERO
low complexity region 2504 2524 N/A INTRINSIC
low complexity region 2584 2601 N/A INTRINSIC
low complexity region 2629 2652 N/A INTRINSIC
low complexity region 2670 2695 N/A INTRINSIC
low complexity region 2707 2742 N/A INTRINSIC
low complexity region 2794 2827 N/A INTRINSIC
Blast:CT 2830 2917 1e-44 BLAST
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.3%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610203C20Rik T C 9: 41,581,376 L116P probably damaging Het
A830018L16Rik A T 1: 11,518,594 R78S probably damaging Het
Acad10 G T 5: 121,626,040 probably benign Het
Acad10 G C 5: 121,626,041 probably benign Het
Ang2 C A 14: 51,195,533 E131* probably null Het
Ankfn1 T C 11: 89,526,541 N82D probably damaging Het
Anks1b T C 10: 90,049,985 I181T possibly damaging Het
Bcl2l12 C G 7: 44,992,818 G215R probably damaging Het
Bnc2 A G 4: 84,275,957 Y1044H probably damaging Het
Cacna1s T C 1: 136,110,937 F1172S probably damaging Het
Cct8 A G 16: 87,485,584 I482T probably damaging Het
Cfap74 C T 4: 155,434,045 T580I probably benign Het
Cib1 A T 7: 80,228,414 Y105* probably null Het
Cpa1 G A 6: 30,642,335 G245D probably damaging Het
Csmd3 A G 15: 47,981,975 V801A possibly damaging Het
Ddx10 T C 9: 53,149,561 probably null Het
Ddx4 T C 13: 112,599,997 N613S probably damaging Het
Drd3 A G 16: 43,821,341 D340G probably benign Het
E2f4 A G 8: 105,304,688 *411W probably null Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Foxp1 A T 6: 98,945,420 I450N probably damaging Het
Gm10229 G A 16: 89,015,389 probably benign Het
Gm5771 G T 6: 41,396,011 L72F probably damaging Het
Gm813 A T 16: 58,615,839 D40E probably benign Het
Gpr19 A G 6: 134,870,084 F175S possibly damaging Het
Gpr21 C T 2: 37,518,072 T210M probably damaging Het
Grhl2 C T 15: 37,336,323 A488V probably benign Het
Hif3a T C 7: 17,044,403 T435A probably benign Het
Hoxb4 C T 11: 96,318,899 R44* probably null Het
Ifi47 A G 11: 49,095,871 D155G probably damaging Het
Igdcc4 T C 9: 65,135,227 L142P probably benign Het
Ints6 G A 14: 62,713,692 P296L probably damaging Het
Itga3 A G 11: 95,046,919 probably null Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Lgals12 A T 19: 7,604,312 H50Q probably benign Het
Lrp12 A G 15: 39,872,506 S696P probably damaging Het
Lrp6 G A 6: 134,459,429 T1258I possibly damaging Het
Meis2 C T 2: 116,058,702 D190N probably damaging Het
Mon2 C T 10: 123,036,007 probably benign Het
Myo15 A G 11: 60,488,238 H1394R probably damaging Het
Myo5a A T 9: 75,171,746 I929F probably damaging Het
Nek6 T A 2: 38,568,895 Y141N probably damaging Het
Notch4 T A 17: 34,568,422 C319S probably damaging Het
Nwd2 A T 5: 63,800,182 D285V probably benign Het
Olfml1 T C 7: 107,590,375 S216P possibly damaging Het
Pabpc1l G T 2: 164,037,171 V313F possibly damaging Het
Pfkfb2 G T 1: 130,698,083 H453Q probably benign Het
Pigt C T 2: 164,501,519 T305I probably benign Het
Plxnb1 C T 9: 109,100,900 L275F possibly damaging Het
Ppm1d C T 11: 85,339,605 R350C probably damaging Het
Rassf1 C A 9: 107,551,846 P84T probably benign Het
Rgl3 G T 9: 21,980,706 R361S probably benign Het
Rnf213 G A 11: 119,442,707 R2914H probably damaging Het
Ryr2 A T 13: 11,554,549 C4956* probably null Het
Scaper C T 9: 55,816,670 R668H probably damaging Het
Spata6 T C 4: 111,779,006 F165L probably benign Het
Tcirg1 A T 19: 3,896,845 W694R probably benign Het
Tmem245 A T 4: 56,906,233 Y160* probably null Het
Tshr T C 12: 91,534,031 Y279H probably damaging Het
Ttf1 A C 2: 29,065,138 K171N probably damaging Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Xdh A G 17: 73,913,901 V611A probably damaging Het
Zfp142 G T 1: 74,570,104 H1408N probably damaging Het
Other mutations in Muc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Muc6 APN 7 141638584 missense probably benign 0.06
IGL00466:Muc6 APN 7 141645902 missense possibly damaging 0.94
IGL00990:Muc6 APN 7 141638890 missense possibly damaging 0.85
IGL01013:Muc6 APN 7 141648066 nonsense probably null
IGL01021:Muc6 APN 7 141637162 missense possibly damaging 0.53
IGL01061:Muc6 APN 7 141648454 missense probably damaging 1.00
IGL01294:Muc6 APN 7 141646659 missense probably damaging 1.00
IGL01449:Muc6 APN 7 141638614 missense possibly damaging 0.92
IGL01474:Muc6 APN 7 141651307 missense probably damaging 1.00
IGL01539:Muc6 APN 7 141650041 missense probably benign 0.07
IGL01541:Muc6 APN 7 141649804 nonsense probably null
IGL01810:Muc6 APN 7 141651062 missense probably damaging 0.97
IGL01941:Muc6 APN 7 141638584 missense probably benign 0.06
IGL01954:Muc6 APN 7 141638584 missense probably benign 0.06
IGL02096:Muc6 APN 7 141639850 intron probably benign
IGL02192:Muc6 APN 7 141637804 missense possibly damaging 0.91
IGL02217:Muc6 APN 7 141649624 missense probably damaging 1.00
IGL02234:Muc6 APN 7 141640575 missense probably benign 0.09
IGL02302:Muc6 APN 7 141641496 missense possibly damaging 0.53
IGL02331:Muc6 APN 7 141640459 missense possibly damaging 0.53
IGL02531:Muc6 APN 7 141636940 missense possibly damaging 0.53
IGL02639:Muc6 APN 7 141649578 splice site probably benign
IGL02851:Muc6 APN 7 141648361 missense probably damaging 1.00
IGL03026:Muc6 APN 7 141640147 intron probably benign
IGL03070:Muc6 APN 7 141644567 splice site probably benign
IGL03108:Muc6 APN 7 141637489 missense possibly damaging 0.93
IGL03350:Muc6 APN 7 141652059 missense probably damaging 1.00
IGL03366:Muc6 APN 7 141648082 missense probably damaging 1.00
F5770:Muc6 UTSW 7 141647613 missense probably benign 0.11
IGL03147:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R0001:Muc6 UTSW 7 141641574 missense possibly damaging 0.53
R0005:Muc6 UTSW 7 141638772 missense possibly damaging 0.72
R0147:Muc6 UTSW 7 141651990 missense probably damaging 1.00
R0153:Muc6 UTSW 7 141634116 missense possibly damaging 0.68
R0227:Muc6 UTSW 7 141639559 intron probably benign
R0234:Muc6 UTSW 7 141649674 missense possibly damaging 0.95
R0234:Muc6 UTSW 7 141649674 missense possibly damaging 0.95
R0304:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R0379:Muc6 UTSW 7 141636955 missense possibly damaging 0.53
R0385:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R0423:Muc6 UTSW 7 141652283 missense probably benign 0.01
R0499:Muc6 UTSW 7 141640468 missense probably benign
R0503:Muc6 UTSW 7 141638772 missense possibly damaging 0.72
R0757:Muc6 UTSW 7 141638584 missense probably benign 0.06
R0792:Muc6 UTSW 7 141639559 intron probably benign
R0880:Muc6 UTSW 7 141637357 missense possibly damaging 0.91
R1136:Muc6 UTSW 7 141638772 missense possibly damaging 0.72
R1170:Muc6 UTSW 7 141644233 missense probably damaging 0.99
R1174:Muc6 UTSW 7 141648101 missense probably damaging 1.00
R1175:Muc6 UTSW 7 141648101 missense probably damaging 1.00
R1189:Muc6 UTSW 7 141645855 missense probably damaging 1.00
R1259:Muc6 UTSW 7 141640197 intron probably benign
R1293:Muc6 UTSW 7 141651990 missense probably damaging 1.00
R1295:Muc6 UTSW 7 141651879 missense probably benign 0.04
R1296:Muc6 UTSW 7 141651879 missense probably benign 0.04
R1471:Muc6 UTSW 7 141647909 missense possibly damaging 0.61
R1472:Muc6 UTSW 7 141651879 missense probably benign 0.04
R1548:Muc6 UTSW 7 141638772 missense possibly damaging 0.72
R1576:Muc6 UTSW 7 141634524 missense possibly damaging 0.92
R1689:Muc6 UTSW 7 141647998 missense probably damaging 1.00
R1702:Muc6 UTSW 7 141650487 missense probably damaging 1.00
R1792:Muc6 UTSW 7 141634458 missense probably benign 0.41
R1924:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R1938:Muc6 UTSW 7 141637098 missense probably damaging 0.99
R1964:Muc6 UTSW 7 141640062 nonsense probably null
R1964:Muc6 UTSW 7 141640063 intron probably benign
R1975:Muc6 UTSW 7 141648101 missense probably damaging 1.00
R2031:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R2104:Muc6 UTSW 7 141634078 missense probably benign 0.23
R2201:Muc6 UTSW 7 141649810 missense probably damaging 1.00
R2218:Muc6 UTSW 7 141646960 missense probably benign 0.41
R2245:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R2261:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R2271:Muc6 UTSW 7 141637510 missense possibly damaging 0.53
R2272:Muc6 UTSW 7 141637510 missense possibly damaging 0.53
R2284:Muc6 UTSW 7 141637924 missense possibly damaging 0.53
R2310:Muc6 UTSW 7 141637531 missense possibly damaging 0.53
R2566:Muc6 UTSW 7 141640384 missense possibly damaging 0.73
R2975:Muc6 UTSW 7 141637038 missense possibly damaging 0.86
R3406:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R3423:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R3548:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R3693:Muc6 UTSW 7 141648681 splice site probably benign
R3872:Muc6 UTSW 7 141640600 missense probably benign
R4029:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R4084:Muc6 UTSW 7 141648655 missense probably damaging 1.00
R4126:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R4410:Muc6 UTSW 7 141637663 missense possibly damaging 0.91
R4508:Muc6 UTSW 7 141640089 intron probably benign
R4509:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R4518:Muc6 UTSW 7 141644222 missense probably benign 0.03
R4594:Muc6 UTSW 7 141638772 missense possibly damaging 0.72
R4677:Muc6 UTSW 7 141639790 intron probably benign
R4678:Muc6 UTSW 7 141644287 missense probably benign 0.09
R4737:Muc6 UTSW 7 141640159 intron probably benign
R4737:Muc6 UTSW 7 141638772 missense possibly damaging 0.72
R4981:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R5008:Muc6 UTSW 7 141639559 intron probably benign
R5012:Muc6 UTSW 7 141636657 missense possibly damaging 0.96
R5017:Muc6 UTSW 7 141640528 missense probably benign
R5027:Muc6 UTSW 7 141636436 missense probably benign 0.01
R5058:Muc6 UTSW 7 141644224 missense probably benign 0.01
R5069:Muc6 UTSW 7 141651299 missense probably damaging 1.00
R5126:Muc6 UTSW 7 141651299 missense probably damaging 1.00
R5168:Muc6 UTSW 7 141639559 intron probably benign
R5179:Muc6 UTSW 7 141638772 missense possibly damaging 0.72
R5198:Muc6 UTSW 7 141638772 missense possibly damaging 0.72
R5262:Muc6 UTSW 7 141651110 missense possibly damaging 0.78
R5381:Muc6 UTSW 7 141637923 missense possibly damaging 0.86
R5454:Muc6 UTSW 7 141648813 missense possibly damaging 0.61
R5467:Muc6 UTSW 7 141636535 missense possibly damaging 0.53
R5540:Muc6 UTSW 7 141649585 critical splice donor site probably null
R5800:Muc6 UTSW 7 141640423 splice site probably benign
R5808:Muc6 UTSW 7 141640093 intron probably benign
R5865:Muc6 UTSW 7 141650504 missense probably damaging 0.97
R5919:Muc6 UTSW 7 141641570 missense possibly damaging 0.56
R6024:Muc6 UTSW 7 141641574 missense possibly damaging 0.53
R6064:Muc6 UTSW 7 141648374 missense probably damaging 1.00
R6126:Muc6 UTSW 7 141638772 missense possibly damaging 0.72
R6229:Muc6 UTSW 7 141640525 missense probably benign
R6236:Muc6 UTSW 7 141638772 missense possibly damaging 0.72
R6245:Muc6 UTSW 7 141648821 missense probably damaging 1.00
R6254:Muc6 UTSW 7 141651115 missense probably benign 0.09
R6418:Muc6 UTSW 7 141639610 intron probably benign
R6609:Muc6 UTSW 7 141640433 splice site probably benign
R6610:Muc6 UTSW 7 141640433 splice site probably benign
R6611:Muc6 UTSW 7 141640433 splice site probably benign
R6623:Muc6 UTSW 7 141639559 intron probably benign
R6626:Muc6 UTSW 7 141639559 intron probably benign
R6817:Muc6 UTSW 7 141651061 missense probably damaging 0.99
R6923:Muc6 UTSW 7 141637540 missense possibly damaging 0.91
R6989:Muc6 UTSW 7 141639979 intron probably benign
R7001:Muc6 UTSW 7 141637407 missense probably damaging 0.99
R7046:Muc6 UTSW 7 141640189 intron probably benign
R7097:Muc6 UTSW 7 141634450 frame shift probably null
R7099:Muc6 UTSW 7 141634450 frame shift probably null
R7101:Muc6 UTSW 7 141634450 frame shift probably null
R7107:Muc6 UTSW 7 141634450 frame shift probably null
R7108:Muc6 UTSW 7 141634450 frame shift probably null
R7112:Muc6 UTSW 7 141649277 missense probably damaging 1.00
R7202:Muc6 UTSW 7 141634450 frame shift probably null
R7204:Muc6 UTSW 7 141634450 frame shift probably null
R7205:Muc6 UTSW 7 141634450 frame shift probably null
R7222:Muc6 UTSW 7 141634515 missense unknown
R7230:Muc6 UTSW 7 141649214 missense probably damaging 1.00
R7278:Muc6 UTSW 7 141640575 missense probably benign 0.09
R7483:Muc6 UTSW 7 141639823 missense unknown
R7501:Muc6 UTSW 7 141637746 missense probably damaging 0.98
V7581:Muc6 UTSW 7 141647613 missense probably benign 0.11
V7583:Muc6 UTSW 7 141647613 missense probably benign 0.11
X0026:Muc6 UTSW 7 141651699 missense possibly damaging 0.94
X0058:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGCTTACCCAATGTCCCTGACAGAG -3'
(R):5'- CCGACACTGAGGATAACCTGCAATC -3'

Sequencing Primer
(F):5'- CCATGATGATCCGGGAGATATTC -3'
(R):5'- TATCTAGGGCCACAGCTTCT -3'
Posted On2014-04-13