Mutagenetix > Incidental Mutations

Incidental Mutation 'R1548:Myo5a'

172338

Institutional Source

Beutler Lab

Gene Symbol

Myo5a

Ensembl Gene

ENSMUSG00000034593

Gene Name

myosin VA

Synonyms

9630007J19Rik, Dbv, flail, MVa, Myo5, MyoVA

MMRRC Submission

039587-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.959) question?

Stock #

R1548 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

75071015-75223688 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 75171746 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 929 (I929F)

Ref Sequence

ENSEMBL: ENSMUSP00000117493 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000123128] [ENSMUST00000123531] [ENSMUST00000136731] [ENSMUST00000155282]

Predicted Effect

probably damaging
Transcript: ENSMUST00000123128
AA Change: I929F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000116028
Gene: ENSMUSG00000034593
AA Change: I929F

Domain	Start	End	E-Value	Type
MYSc	63	764	N/A	SMART
IQ	765	787	3.65e-4	SMART
IQ	788	810	1.56e-3	SMART
IQ	813	835	3.05e-6	SMART
IQ	836	858	8.38e-4	SMART
IQ	861	883	1.09e-2	SMART
IQ	884	906	6.97e0	SMART
coiled coil region	1153	1234	N/A	INTRINSIC
coiled coil region	1314	1364	N/A	INTRINSIC
coiled coil region	1406	1443	N/A	INTRINSIC
DIL	1685	1790	2.47e-51	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000123531

Predicted Effect

probably damaging
Transcript: ENSMUST00000136731
AA Change: I929F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000120444
Gene: ENSMUSG00000034593
AA Change: I929F

Domain	Start	End	E-Value	Type
MYSc	63	764	N/A	SMART
IQ	765	787	3.65e-4	SMART
IQ	788	810	1.56e-3	SMART
IQ	813	835	3.05e-6	SMART
IQ	836	858	8.38e-4	SMART
IQ	861	883	1.09e-2	SMART
IQ	884	906	6.97e0	SMART
coiled coil region	1153	1234	N/A	INTRINSIC
coiled coil region	1314	1418	N/A	INTRINSIC
DIL	1660	1765	2.47e-51	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000155282
AA Change: I929F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000117493
Gene: ENSMUSG00000034593
AA Change: I929F

Domain	Start	End	E-Value	Type
MYSc	63	764	N/A	SMART
IQ	765	787	3.65e-4	SMART
IQ	788	810	1.56e-3	SMART
IQ	813	835	3.05e-6	SMART
IQ	836	858	8.38e-4	SMART
IQ	861	883	1.09e-2	SMART
IQ	884	906	6.97e0	SMART
coiled coil region	1153	1234	N/A	INTRINSIC
coiled coil region	1339	1445	N/A	INTRINSIC
DIL	1687	1792	2.47e-51	SMART

Meta Mutation Damage Score

0.3235

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.9%
20x: 91.3%

Validation Efficiency

99% (69/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of three myosin V heavy-chain genes, belonging to the myosin gene superfamily. Myosin V is a class of actin-based motor proteins involved in cytoplasmic vesicle transport and anchorage, spindle-pole alignment and mRNA translocation. The protein encoded by this gene is abundant in melanocytes and nerve cells. Mutations in this gene cause Griscelli syndrome type-1 (GS1), Griscelli syndrome type-3 (GS3) and neuroectodermal melanolysosomal disease, or Elejalde disease. Multiple alternatively spliced transcript variants encoding different isoforms have been reported, but the full-length nature of some variants has not been determined. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mutations in this gene result in diluted coat color, behavioral deficits including opisthotonus, and postnatal or premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610203C20Rik	T	C	9: 41,581,376	L116P	probably damaging	Het
A830018L16Rik	A	T	1: 11,518,594	R78S	probably damaging	Het
Acad10	G	T	5: 121,626,040		probably benign	Het
Acad10	G	C	5: 121,626,041		probably benign	Het
Ang2	C	A	14: 51,195,533	E131*	probably null	Het
Ankfn1	T	C	11: 89,526,541	N82D	probably damaging	Het
Anks1b	T	C	10: 90,049,985	I181T	possibly damaging	Het
Bcl2l12	C	G	7: 44,992,818	G215R	probably damaging	Het
Bnc2	A	G	4: 84,275,957	Y1044H	probably damaging	Het
Cacna1s	T	C	1: 136,110,937	F1172S	probably damaging	Het
Cct8	A	G	16: 87,485,584	I482T	probably damaging	Het
Cfap74	C	T	4: 155,434,045	T580I	probably benign	Het
Cib1	A	T	7: 80,228,414	Y105*	probably null	Het
Cpa1	G	A	6: 30,642,335	G245D	probably damaging	Het
Csmd3	A	G	15: 47,981,975	V801A	possibly damaging	Het
Ddx10	T	C	9: 53,149,561		probably null	Het
Ddx4	T	C	13: 112,599,997	N613S	probably damaging	Het
Drd3	A	G	16: 43,821,341	D340G	probably benign	Het
E2f4	A	G	8: 105,304,688	*411W	probably null	Het
Fmnl2	A	G	2: 53,105,537	E424G	probably damaging	Het
Foxp1	A	T	6: 98,945,420	I450N	probably damaging	Het
Gm10229	G	A	16: 89,015,389		probably benign	Het
Gm5771	G	T	6: 41,396,011	L72F	probably damaging	Het
Gm813	A	T	16: 58,615,839	D40E	probably benign	Het
Gpr19	A	G	6: 134,870,084	F175S	possibly damaging	Het
Gpr21	C	T	2: 37,518,072	T210M	probably damaging	Het
Grhl2	C	T	15: 37,336,323	A488V	probably benign	Het
Hif3a	T	C	7: 17,044,403	T435A	probably benign	Het
Hoxb4	C	T	11: 96,318,899	R44*	probably null	Het
Ifi47	A	G	11: 49,095,871	D155G	probably damaging	Het
Igdcc4	T	C	9: 65,135,227	L142P	probably benign	Het
Ints6	G	A	14: 62,713,692	P296L	probably damaging	Het
Itga3	A	G	11: 95,046,919		probably null	Het
Klra3	G	C	6: 130,333,144	R138G	probably benign	Het
Lgals12	A	T	19: 7,604,312	H50Q	probably benign	Het
Lrp12	A	G	15: 39,872,506	S696P	probably damaging	Het
Lrp6	G	A	6: 134,459,429	T1258I	possibly damaging	Het
Meis2	C	T	2: 116,058,702	D190N	probably damaging	Het
Mon2	C	T	10: 123,036,007		probably benign	Het
Muc6	G	T	7: 141,638,772	T1996N	possibly damaging	Het
Muc6	A	G	7: 141,652,103		probably benign	Het
Myo15	A	G	11: 60,488,238	H1394R	probably damaging	Het
Nek6	T	A	2: 38,568,895	Y141N	probably damaging	Het
Notch4	T	A	17: 34,568,422	C319S	probably damaging	Het
Nwd2	A	T	5: 63,800,182	D285V	probably benign	Het
Olfml1	T	C	7: 107,590,375	S216P	possibly damaging	Het
Pabpc1l	G	T	2: 164,037,171	V313F	possibly damaging	Het
Pfkfb2	G	T	1: 130,698,083	H453Q	probably benign	Het
Pigt	C	T	2: 164,501,519	T305I	probably benign	Het
Plxnb1	C	T	9: 109,100,900	L275F	possibly damaging	Het
Ppm1d	C	T	11: 85,339,605	R350C	probably damaging	Het
Rassf1	C	A	9: 107,551,846	P84T	probably benign	Het
Rgl3	G	T	9: 21,980,706	R361S	probably benign	Het
Rnf213	G	A	11: 119,442,707	R2914H	probably damaging	Het
Ryr2	A	T	13: 11,554,549	C4956*	probably null	Het
Scaper	C	T	9: 55,816,670	R668H	probably damaging	Het
Spata6	T	C	4: 111,779,006	F165L	probably benign	Het
Tcirg1	A	T	19: 3,896,845	W694R	probably benign	Het
Tmem245	A	T	4: 56,906,233	Y160*	probably null	Het
Tshr	T	C	12: 91,534,031	Y279H	probably damaging	Het
Ttf1	A	C	2: 29,065,138	K171N	probably damaging	Het
Ubap2	C	T	4: 41,199,872	A752T	probably benign	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Xdh	A	G	17: 73,913,901	V611A	probably damaging	Het
Zfp142	G	T	1: 74,570,104	H1408N	probably damaging	Het

Other mutations in Myo5a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Myo5a	APN	9	75161497	nonsense	probably null
IGL00547:Myo5a	APN	9	75141453	missense	probably benign	0.00
IGL00788:Myo5a	APN	9	75168959	missense	probably benign	0.15
IGL01327:Myo5a	APN	9	75187538	splice site	probably benign
IGL01687:Myo5a	APN	9	75156249	missense	probably benign	0.12
IGL01886:Myo5a	APN	9	75169090	splice site	probably benign
IGL01945:Myo5a	APN	9	75140671	missense	probably damaging	1.00
IGL02127:Myo5a	APN	9	75212981	missense	probably benign	0.12
IGL02137:Myo5a	APN	9	75161535	splice site	probably null
IGL02183:Myo5a	APN	9	75167236	splice site	probably benign
IGL02427:Myo5a	APN	9	75176618	splice site	probably benign
IGL02490:Myo5a	APN	9	75136455	missense	probably damaging	1.00
IGL02574:Myo5a	APN	9	75211147	missense	probably benign	0.00
IGL02886:Myo5a	APN	9	75151887	splice site	probably benign
IGL02961:Myo5a	APN	9	75215120	missense	probably benign	0.04
IGL03090:Myo5a	APN	9	75120833	missense	probably damaging	1.00
IGL03119:Myo5a	APN	9	75174015	missense	probably benign	0.01
IGL03237:Myo5a	APN	9	75129994	missense	probably damaging	1.00
IGL03296:Myo5a	APN	9	75116202	missense	probably damaging	1.00
naoki	UTSW	9	75161492	missense	probably damaging	1.00
new_gray	UTSW	9		missense
nut	UTSW	9		splice donor site
silver_decerebrate	UTSW	9	75164195	missense	probably damaging	1.00
silver_decerebrate_2	UTSW	9	75211127	missense	probably damaging	1.00
IGL02988:Myo5a	UTSW	9	75130141	splice site	probably benign
IGL03050:Myo5a	UTSW	9	75146909	unclassified	probably null
PIT4403001:Myo5a	UTSW	9	75217523	missense	probably damaging	1.00
R0047:Myo5a	UTSW	9	75156207	missense	probably damaging	1.00
R0047:Myo5a	UTSW	9	75156207	missense	probably damaging	1.00
R0091:Myo5a	UTSW	9	75161492	missense	probably damaging	1.00
R0142:Myo5a	UTSW	9	75160574	missense	probably benign	0.01
R0243:Myo5a	UTSW	9	75186123	critical splice donor site	probably null
R0395:Myo5a	UTSW	9	75193977	missense	probably benign	0.39
R0427:Myo5a	UTSW	9	75174196	missense	probably benign	0.00
R0545:Myo5a	UTSW	9	75167037	missense	possibly damaging	0.94
R0565:Myo5a	UTSW	9	75180112	missense	probably benign	0.00
R0601:Myo5a	UTSW	9	75174015	missense	probably benign	0.01
R1457:Myo5a	UTSW	9	75213065	missense	probably damaging	0.99
R1510:Myo5a	UTSW	9	75171551	missense	probably benign
R1759:Myo5a	UTSW	9	75181993	missense	possibly damaging	0.72
R1924:Myo5a	UTSW	9	75116207	missense	probably damaging	1.00
R1960:Myo5a	UTSW	9	75147857	missense	probably damaging	1.00
R2050:Myo5a	UTSW	9	75146874	missense	probably benign	0.01
R2070:Myo5a	UTSW	9	75181984	missense	probably benign	0.03
R2075:Myo5a	UTSW	9	75189918	missense	probably benign	0.01
R2148:Myo5a	UTSW	9	75180147	missense	probably damaging	1.00
R2201:Myo5a	UTSW	9	75217943	missense	possibly damaging	0.51
R2337:Myo5a	UTSW	9	75203801	missense	probably damaging	1.00
R2357:Myo5a	UTSW	9	75201365	missense	probably damaging	0.99
R2392:Myo5a	UTSW	9	75209239	missense	probably benign	0.02
R2432:Myo5a	UTSW	9	75212873	missense	possibly damaging	0.89
R2568:Myo5a	UTSW	9	75123040	missense	probably damaging	1.00
R2568:Myo5a	UTSW	9	75151897	missense	probably damaging	1.00
R2932:Myo5a	UTSW	9	75196136	missense	possibly damaging	0.85
R2971:Myo5a	UTSW	9	75116202	missense	probably damaging	1.00
R4231:Myo5a	UTSW	9	75189997	missense	possibly damaging	0.67
R4293:Myo5a	UTSW	9	75144171	missense	probably benign
R4321:Myo5a	UTSW	9	75217530	missense	probably damaging	0.99
R4450:Myo5a	UTSW	9	75167176	missense	probably benign	0.00
R4573:Myo5a	UTSW	9	75201297	synonymous	probably null
R4577:Myo5a	UTSW	9	75217545	missense	probably damaging	1.00
R4601:Myo5a	UTSW	9	75136388	missense	probably damaging	1.00
R4690:Myo5a	UTSW	9	75153823	missense	probably damaging	0.99
R4691:Myo5a	UTSW	9	75180156	missense	probably damaging	0.99
R4764:Myo5a	UTSW	9	75116336	intron	probably benign
R4767:Myo5a	UTSW	9	75144076	missense	probably damaging	0.99
R4811:Myo5a	UTSW	9	75141543	critical splice donor site	probably null
R4829:Myo5a	UTSW	9	75136407	missense	probably damaging	1.00
R4863:Myo5a	UTSW	9	75217507	missense	probably damaging	1.00
R4902:Myo5a	UTSW	9	75174078	missense	probably benign
R4947:Myo5a	UTSW	9	75123048	missense	probably damaging	1.00
R5074:Myo5a	UTSW	9	75174156	missense	probably benign
R5095:Myo5a	UTSW	9	75152020	missense	probably damaging	1.00
R5095:Myo5a	UTSW	9	75184389	nonsense	probably null
R5254:Myo5a	UTSW	9	75130120	missense	probably damaging	1.00
R5267:Myo5a	UTSW	9	75152010	missense	probably damaging	1.00
R5419:Myo5a	UTSW	9	75147897	missense	probably damaging	1.00
R5514:Myo5a	UTSW	9	75153766	missense	probably damaging	1.00
R5629:Myo5a	UTSW	9	75203845	missense	possibly damaging	0.89
R5649:Myo5a	UTSW	9	75171719	missense	possibly damaging	0.92
R5661:Myo5a	UTSW	9	75167206	missense	probably benign	0.02
R5665:Myo5a	UTSW	9	75144181	critical splice donor site	probably null
R5719:Myo5a	UTSW	9	75151931	missense	probably damaging	1.00
R5964:Myo5a	UTSW	9	75203833	missense	probably benign	0.09
R6014:Myo5a	UTSW	9	75167207	nonsense	probably null
R6344:Myo5a	UTSW	9	75160509	missense	probably benign	0.09
R6345:Myo5a	UTSW	9	75189913	missense	possibly damaging	0.77
R6644:Myo5a	UTSW	9	75146967	missense	probably damaging	0.98
R6712:Myo5a	UTSW	9	75212900	missense	probably benign	0.12
R6838:Myo5a	UTSW	9	75153883	critical splice donor site	probably null
R6866:Myo5a	UTSW	9	75140688	missense	probably damaging	1.00
R6876:Myo5a	UTSW	9	75160490	missense	probably benign	0.04
R7108:Myo5a	UTSW	9	75129992	missense	probably damaging	1.00
R7159:Myo5a	UTSW	9	75171563	missense	probably benign	0.07
R7164:Myo5a	UTSW	9	75180153	missense	probably benign	0.00
R7219:Myo5a	UTSW	9	75120770	missense	probably damaging	1.00
R7497:Myo5a	UTSW	9	75197701	missense
R7620:Myo5a	UTSW	9	75164136	missense	probably benign	0.41
R7719:Myo5a	UTSW	9	75144084	missense	probably benign	0.01
R7810:Myo5a	UTSW	9	75160465	missense	probably benign	0.09
R7810:Myo5a	UTSW	9	75169010	missense	probably benign
R7866:Myo5a	UTSW	9	75203752	missense	probably damaging	1.00
R7949:Myo5a	UTSW	9	75203752	missense	probably damaging	1.00
X0010:Myo5a	UTSW	9	75185905	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTGGCCCGTACACATTATAAGAGG -3'
(R):5'- TCTTGCCACTGCCATGCCAAAC -3'

Sequencing Primer
(F):5'- GGACCATGAAAGCCATCGTC -3'
(R):5'- CATGCCAAACAACTGTTGGAG -3'

Posted On

2014-04-13