Incidental Mutation 'R1548:Ppm1d'
ID 172345
Institutional Source Beutler Lab
Gene Symbol Ppm1d
Ensembl Gene ENSMUSG00000020525
Gene Name protein phosphatase 1D magnesium-dependent, delta isoform
Synonyms Wip1
MMRRC Submission 039587-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1548 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 85311244-85347066 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 85339605 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 350 (R350C)
Ref Sequence ENSEMBL: ENSMUSP00000020835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020835] [ENSMUST00000127717]
AlphaFold Q9QZ67
Predicted Effect probably damaging
Transcript: ENSMUST00000020835
AA Change: R350C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020835
Gene: ENSMUSG00000020525
AA Change: R350C

PP2Cc 1 366 1.4e-76 SMART
PP2C_SIG 78 368 6.09e0 SMART
low complexity region 403 415 N/A INTRINSIC
Blast:PP2Cc 416 476 1e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000127717
SMART Domains Protein: ENSMUSP00000115606
Gene: ENSMUSG00000020525

PP2Cc 1 170 2.87e-5 SMART
Meta Mutation Damage Score 0.5098 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.3%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the PP2C family of Ser/Thr protein phosphatases. PP2C family members are known to be negative regulators of cell stress response pathways. The expression of this gene is induced in a p53-dependent manner in response to various environmental stresses. While being induced by tumor suppressor protein TP53/p53, this phosphatase negatively regulates the activity of p38 MAP kinase, MAPK/p38, through which it reduces the phosphorylation of p53, and in turn suppresses p53-mediated transcription and apoptosis. This phosphatase thus mediates a feedback regulation of p38-p53 signaling that contributes to growth inhibition and the suppression of stress induced apoptosis. This gene is located in a chromosomal region known to be amplified in breast cancer. The amplification of this gene has been detected in both breast cancer cell line and primary breast tumors, which suggests a role of this gene in cancer development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null male mice show some embryonic lethality. Surviving males have variable abnormalities including runting, reproductive organ atrophy with associated reduced fertility, and reduced life span. Both genders have increased susceptibility to viral infection and reduced lymphocyte function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610203C20Rik T C 9: 41,581,376 L116P probably damaging Het
A830018L16Rik A T 1: 11,518,594 R78S probably damaging Het
Acad10 G T 5: 121,626,040 probably benign Het
Acad10 G C 5: 121,626,041 probably benign Het
Ang2 C A 14: 51,195,533 E131* probably null Het
Ankfn1 T C 11: 89,526,541 N82D probably damaging Het
Anks1b T C 10: 90,049,985 I181T possibly damaging Het
Bcl2l12 C G 7: 44,992,818 G215R probably damaging Het
Bnc2 A G 4: 84,275,957 Y1044H probably damaging Het
Cacna1s T C 1: 136,110,937 F1172S probably damaging Het
Cct8 A G 16: 87,485,584 I482T probably damaging Het
Cfap74 C T 4: 155,434,045 T580I probably benign Het
Cib1 A T 7: 80,228,414 Y105* probably null Het
Cpa1 G A 6: 30,642,335 G245D probably damaging Het
Csmd3 A G 15: 47,981,975 V801A possibly damaging Het
Ddx10 T C 9: 53,149,561 probably null Het
Ddx4 T C 13: 112,599,997 N613S probably damaging Het
Drd3 A G 16: 43,821,341 D340G probably benign Het
E2f4 A G 8: 105,304,688 *411W probably null Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Foxp1 A T 6: 98,945,420 I450N probably damaging Het
Gm10229 G A 16: 89,015,389 probably benign Het
Gm5771 G T 6: 41,396,011 L72F probably damaging Het
Gm813 A T 16: 58,615,839 D40E probably benign Het
Gpr19 A G 6: 134,870,084 F175S possibly damaging Het
Gpr21 C T 2: 37,518,072 T210M probably damaging Het
Grhl2 C T 15: 37,336,323 A488V probably benign Het
Hif3a T C 7: 17,044,403 T435A probably benign Het
Hoxb4 C T 11: 96,318,899 R44* probably null Het
Ifi47 A G 11: 49,095,871 D155G probably damaging Het
Igdcc4 T C 9: 65,135,227 L142P probably benign Het
Ints6 G A 14: 62,713,692 P296L probably damaging Het
Itga3 A G 11: 95,046,919 probably null Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Lgals12 A T 19: 7,604,312 H50Q probably benign Het
Lrp12 A G 15: 39,872,506 S696P probably damaging Het
Lrp6 G A 6: 134,459,429 T1258I possibly damaging Het
Meis2 C T 2: 116,058,702 D190N probably damaging Het
Mon2 C T 10: 123,036,007 probably benign Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Muc6 A G 7: 141,652,103 probably benign Het
Myo15 A G 11: 60,488,238 H1394R probably damaging Het
Myo5a A T 9: 75,171,746 I929F probably damaging Het
Nek6 T A 2: 38,568,895 Y141N probably damaging Het
Notch4 T A 17: 34,568,422 C319S probably damaging Het
Nwd2 A T 5: 63,800,182 D285V probably benign Het
Olfml1 T C 7: 107,590,375 S216P possibly damaging Het
Pabpc1l G T 2: 164,037,171 V313F possibly damaging Het
Pfkfb2 G T 1: 130,698,083 H453Q probably benign Het
Pigt C T 2: 164,501,519 T305I probably benign Het
Plxnb1 C T 9: 109,100,900 L275F possibly damaging Het
Rassf1 C A 9: 107,551,846 P84T probably benign Het
Rgl3 G T 9: 21,980,706 R361S probably benign Het
Rnf213 G A 11: 119,442,707 R2914H probably damaging Het
Ryr2 A T 13: 11,554,549 C4956* probably null Het
Scaper C T 9: 55,816,670 R668H probably damaging Het
Spata6 T C 4: 111,779,006 F165L probably benign Het
Tcirg1 A T 19: 3,896,845 W694R probably benign Het
Tmem245 A T 4: 56,906,233 Y160* probably null Het
Tshr T C 12: 91,534,031 Y279H probably damaging Het
Ttf1 A C 2: 29,065,138 K171N probably damaging Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Xdh A G 17: 73,913,901 V611A probably damaging Het
Zfp142 G T 1: 74,570,104 H1408N probably damaging Het
Other mutations in Ppm1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02095:Ppm1d APN 11 85327006 missense probably benign 0.04
IGL02351:Ppm1d APN 11 85345715 missense probably damaging 0.99
IGL02358:Ppm1d APN 11 85345715 missense probably damaging 0.99
IGL02496:Ppm1d APN 11 85339666 missense possibly damaging 0.51
IGL02667:Ppm1d APN 11 85332285 missense probably damaging 1.00
IGL02885:Ppm1d APN 11 85326944 missense possibly damaging 0.52
IGL03085:Ppm1d APN 11 85337163 missense probably null 0.80
R0114:Ppm1d UTSW 11 85326905 missense probably damaging 1.00
R0606:Ppm1d UTSW 11 85345877 missense probably benign 0.27
R1014:Ppm1d UTSW 11 85337154 missense probably damaging 0.98
R3774:Ppm1d UTSW 11 85337167 missense probably damaging 1.00
R3775:Ppm1d UTSW 11 85337167 missense probably damaging 1.00
R4025:Ppm1d UTSW 11 85345757 missense probably benign 0.09
R4065:Ppm1d UTSW 11 85345852 missense probably benign 0.01
R4067:Ppm1d UTSW 11 85345852 missense probably benign 0.01
R4118:Ppm1d UTSW 11 85311582 missense probably benign 0.01
R5169:Ppm1d UTSW 11 85332370 missense probably damaging 1.00
R5384:Ppm1d UTSW 11 85311783 missense probably damaging 0.98
R5861:Ppm1d UTSW 11 85311848 missense possibly damaging 0.70
R5890:Ppm1d UTSW 11 85326908 missense probably damaging 1.00
R6394:Ppm1d UTSW 11 85339672 missense probably benign
R6992:Ppm1d UTSW 11 85332352 missense probably damaging 1.00
R7006:Ppm1d UTSW 11 85337151 missense possibly damaging 0.92
R7297:Ppm1d UTSW 11 85345995 missense probably damaging 1.00
R7993:Ppm1d UTSW 11 85326951 missense probably damaging 1.00
R8099:Ppm1d UTSW 11 85339666 missense possibly damaging 0.51
R8697:Ppm1d UTSW 11 85337160 missense possibly damaging 0.95
R8738:Ppm1d UTSW 11 85345906 missense probably damaging 0.99
R9018:Ppm1d UTSW 11 85337135 missense probably damaging 0.98
R9188:Ppm1d UTSW 11 85345921 missense possibly damaging 0.93
Z1176:Ppm1d UTSW 11 85339573 missense probably benign 0.09
Z1177:Ppm1d UTSW 11 85326963 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- ccctctgtcttggaatgcttg -3'
Posted On 2014-04-13