Mutagenetix > Incidental Mutation

Incidental Mutation 'R1548:Xdh'

172363

Institutional Source

Beutler Lab

Gene Symbol

Xdh

Ensembl Gene

ENSMUSG00000024066

Gene Name

xanthine dehydrogenase

Synonyms

xanthine oxidase, XO, Xor, Xox1, Xox-1

MMRRC Submission

039587-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.299) question?

Stock #

R1548 (G1)

Quality Score

200

Status

Validated

Chromosome

Chromosomal Location

73883908-73950182 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 73913901 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 611 (V611A)

Ref Sequence

ENSEMBL: ENSMUSP00000024866 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024866]

AlphaFold

Q00519

Predicted Effect

probably damaging
Transcript: ENSMUST00000024866
AA Change: V611A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000024866
Gene: ENSMUSG00000024066
AA Change: V611A

Domain	Start	End	E-Value	Type
Pfam:Fer2	11	81	5e-12	PFAM
Pfam:Fer2_2	90	163	4.1e-31	PFAM
low complexity region	169	182	N/A	INTRINSIC
Pfam:FAD_binding_5	234	414	4.9e-47	PFAM
CO_deh_flav_C	421	525	1.16e-24	SMART
Ald_Xan_dh_C	590	696	1.23e-46	SMART
Pfam:Ald_Xan_dh_C2	704	1239	1e-200	PFAM

Meta Mutation Damage Score

0.5786

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.9%
20x: 91.3%

Validation Efficiency

99% (69/70)

MGI Phenotype

FUNCTION: This gene encodes a member of the xanthine dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The encoded protein exists as two distinct enzymatic forms, either as xanthine dehydrogenase, or as xanthine oxidase, and functions in purine degradation. Additional studies also suggest a role in adipogenesis, and a function as a structural protein in milk fat droplets in the lactating mammary gland. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele are small and die prematurely while heterozygous females show a lactation defect. Most homozygotes for another null allele die within the first month of renal failure associated with uric acid depletion, renal tubular damage, inflammation, fibrosis and oxidative stress. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610203C20Rik	T	C	9: 41,581,376	L116P	probably damaging	Het
A830018L16Rik	A	T	1: 11,518,594	R78S	probably damaging	Het
Acad10	G	T	5: 121,626,040		probably benign	Het
Acad10	G	C	5: 121,626,041		probably benign	Het
Ang2	C	A	14: 51,195,533	E131*	probably null	Het
Ankfn1	T	C	11: 89,526,541	N82D	probably damaging	Het
Anks1b	T	C	10: 90,049,985	I181T	possibly damaging	Het
Bcl2l12	C	G	7: 44,992,818	G215R	probably damaging	Het
Bnc2	A	G	4: 84,275,957	Y1044H	probably damaging	Het
Cacna1s	T	C	1: 136,110,937	F1172S	probably damaging	Het
Cct8	A	G	16: 87,485,584	I482T	probably damaging	Het
Cfap74	C	T	4: 155,434,045	T580I	probably benign	Het
Cib1	A	T	7: 80,228,414	Y105*	probably null	Het
Cpa1	G	A	6: 30,642,335	G245D	probably damaging	Het
Csmd3	A	G	15: 47,981,975	V801A	possibly damaging	Het
Ddx10	T	C	9: 53,149,561		probably null	Het
Ddx4	T	C	13: 112,599,997	N613S	probably damaging	Het
Drd3	A	G	16: 43,821,341	D340G	probably benign	Het
E2f4	A	G	8: 105,304,688	*411W	probably null	Het
Fmnl2	A	G	2: 53,105,537	E424G	probably damaging	Het
Foxp1	A	T	6: 98,945,420	I450N	probably damaging	Het
Gm10229	G	A	16: 89,015,389		probably benign	Het
Gm5771	G	T	6: 41,396,011	L72F	probably damaging	Het
Gm813	A	T	16: 58,615,839	D40E	probably benign	Het
Gpr19	A	G	6: 134,870,084	F175S	possibly damaging	Het
Gpr21	C	T	2: 37,518,072	T210M	probably damaging	Het
Grhl2	C	T	15: 37,336,323	A488V	probably benign	Het
Hif3a	T	C	7: 17,044,403	T435A	probably benign	Het
Hoxb4	C	T	11: 96,318,899	R44*	probably null	Het
Ifi47	A	G	11: 49,095,871	D155G	probably damaging	Het
Igdcc4	T	C	9: 65,135,227	L142P	probably benign	Het
Ints6	G	A	14: 62,713,692	P296L	probably damaging	Het
Itga3	A	G	11: 95,046,919		probably null	Het
Klra3	G	C	6: 130,333,144	R138G	probably benign	Het
Lgals12	A	T	19: 7,604,312	H50Q	probably benign	Het
Lrp12	A	G	15: 39,872,506	S696P	probably damaging	Het
Lrp6	G	A	6: 134,459,429	T1258I	possibly damaging	Het
Meis2	C	T	2: 116,058,702	D190N	probably damaging	Het
Mon2	C	T	10: 123,036,007		probably benign	Het
Muc6	G	T	7: 141,638,772	T1996N	possibly damaging	Het
Muc6	A	G	7: 141,652,103		probably benign	Het
Myo15	A	G	11: 60,488,238	H1394R	probably damaging	Het
Myo5a	A	T	9: 75,171,746	I929F	probably damaging	Het
Nek6	T	A	2: 38,568,895	Y141N	probably damaging	Het
Notch4	T	A	17: 34,568,422	C319S	probably damaging	Het
Nwd2	A	T	5: 63,800,182	D285V	probably benign	Het
Olfml1	T	C	7: 107,590,375	S216P	possibly damaging	Het
Pabpc1l	G	T	2: 164,037,171	V313F	possibly damaging	Het
Pfkfb2	G	T	1: 130,698,083	H453Q	probably benign	Het
Pigt	C	T	2: 164,501,519	T305I	probably benign	Het
Plxnb1	C	T	9: 109,100,900	L275F	possibly damaging	Het
Ppm1d	C	T	11: 85,339,605	R350C	probably damaging	Het
Rassf1	C	A	9: 107,551,846	P84T	probably benign	Het
Rgl3	G	T	9: 21,980,706	R361S	probably benign	Het
Rnf213	G	A	11: 119,442,707	R2914H	probably damaging	Het
Ryr2	A	T	13: 11,554,549	C4956*	probably null	Het
Scaper	C	T	9: 55,816,670	R668H	probably damaging	Het
Spata6	T	C	4: 111,779,006	F165L	probably benign	Het
Tcirg1	A	T	19: 3,896,845	W694R	probably benign	Het
Tmem245	A	T	4: 56,906,233	Y160*	probably null	Het
Tshr	T	C	12: 91,534,031	Y279H	probably damaging	Het
Ttf1	A	C	2: 29,065,138	K171N	probably damaging	Het
Ubap2	C	T	4: 41,199,872	A752T	probably benign	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Zfp142	G	T	1: 74,570,104	H1408N	probably damaging	Het

Other mutations in Xdh

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00493:Xdh	APN	17	73923106	missense	possibly damaging	0.58
IGL00556:Xdh	APN	17	73884435	makesense	probably null
IGL01524:Xdh	APN	17	73923137	critical splice acceptor site	probably null
IGL01604:Xdh	APN	17	73909337	missense	probably benign	0.02
IGL01625:Xdh	APN	17	73916786	critical splice donor site	probably null
IGL01778:Xdh	APN	17	73900280	missense	probably benign	0.00
IGL01804:Xdh	APN	17	73892759	missense	probably damaging	1.00
IGL01825:Xdh	APN	17	73891245	missense	probably damaging	1.00
IGL01929:Xdh	APN	17	73934855	missense	probably damaging	1.00
IGL02068:Xdh	APN	17	73913950	missense	probably damaging	1.00
IGL02079:Xdh	APN	17	73891277	missense	probably damaging	1.00
IGL02210:Xdh	APN	17	73943895	missense	probably benign	0.00
IGL02261:Xdh	APN	17	73913965	missense	possibly damaging	0.81
IGL02365:Xdh	APN	17	73943890	missense	probably benign	0.14
IGL02424:Xdh	APN	17	73926570	missense	probably benign	0.00
IGL02491:Xdh	APN	17	73886464	missense	probably damaging	0.99
IGL02525:Xdh	APN	17	73924995	missense	possibly damaging	0.91
IGL02578:Xdh	APN	17	73906246	missense	probably damaging	1.00
IGL02793:Xdh	APN	17	73900581	missense	probably damaging	1.00
IGL02939:Xdh	APN	17	73943845	critical splice donor site	probably null
IGL03327:Xdh	APN	17	73916792	missense	probably benign
IGL03345:Xdh	APN	17	73906032	missense	probably damaging	0.98
IGL03353:Xdh	APN	17	73895786	missense	possibly damaging	0.65
inky	UTSW	17	73921351	missense	probably damaging	1.00
nucleus	UTSW	17	73899012	nonsense	probably null
squidgame	UTSW	17	73939836	missense	probably benign
R0018:Xdh	UTSW	17	73925025	missense	probably benign	0.00
R0018:Xdh	UTSW	17	73925025	missense	probably benign	0.00
R0033:Xdh	UTSW	17	73907632	missense	probably benign	0.06
R0079:Xdh	UTSW	17	73891218	missense	probably damaging	1.00
R0086:Xdh	UTSW	17	73884438	missense	probably benign
R0319:Xdh	UTSW	17	73906101	splice site	probably benign
R0336:Xdh	UTSW	17	73922463	missense	possibly damaging	0.91
R0389:Xdh	UTSW	17	73898362	missense	probably damaging	1.00
R0684:Xdh	UTSW	17	73943891	missense	probably damaging	0.97
R0930:Xdh	UTSW	17	73923082	missense	probably benign	0.00
R1073:Xdh	UTSW	17	73939836	missense	probably benign
R1114:Xdh	UTSW	17	73941149	splice site	probably benign
R1201:Xdh	UTSW	17	73918418	missense	probably benign	0.05
R1230:Xdh	UTSW	17	73891256	missense	probably damaging	1.00
R1351:Xdh	UTSW	17	73923078	missense	probably benign	0.02
R1470:Xdh	UTSW	17	73891112	missense	probably damaging	1.00
R1470:Xdh	UTSW	17	73891112	missense	probably damaging	1.00
R1485:Xdh	UTSW	17	73914019	nonsense	probably null
R1637:Xdh	UTSW	17	73900578	missense	probably benign
R1641:Xdh	UTSW	17	73926552	missense	probably benign
R1758:Xdh	UTSW	17	73910209	missense	probably damaging	1.00
R1951:Xdh	UTSW	17	73907658	missense	probably damaging	1.00
R1969:Xdh	UTSW	17	73892751	missense	possibly damaging	0.55
R2024:Xdh	UTSW	17	73921305	missense	possibly damaging	0.92
R2080:Xdh	UTSW	17	73909325	missense	probably damaging	1.00
R2157:Xdh	UTSW	17	73922537	missense	probably damaging	1.00
R2300:Xdh	UTSW	17	73891265	missense	probably damaging	1.00
R3783:Xdh	UTSW	17	73893595	splice site	probably benign
R3796:Xdh	UTSW	17	73907658	missense	probably damaging	1.00
R3797:Xdh	UTSW	17	73907658	missense	probably damaging	1.00
R3798:Xdh	UTSW	17	73907658	missense	probably damaging	1.00
R3799:Xdh	UTSW	17	73907658	missense	probably damaging	1.00
R3819:Xdh	UTSW	17	73906725	missense	probably benign	0.35
R4085:Xdh	UTSW	17	73916879	missense	probably benign	0.35
R4240:Xdh	UTSW	17	73895795	missense	possibly damaging	0.72
R4356:Xdh	UTSW	17	73915690	missense	probably benign	0.01
R4522:Xdh	UTSW	17	73898344	missense	probably damaging	1.00
R4523:Xdh	UTSW	17	73898344	missense	probably damaging	1.00
R4524:Xdh	UTSW	17	73898344	missense	probably damaging	1.00
R4600:Xdh	UTSW	17	73910200	missense	probably benign	0.19
R4617:Xdh	UTSW	17	73918394	missense	probably damaging	0.99
R4756:Xdh	UTSW	17	73886386	missense	probably benign	0.24
R4761:Xdh	UTSW	17	73910267	missense	possibly damaging	0.91
R4815:Xdh	UTSW	17	73906215	missense	probably damaging	1.00
R4850:Xdh	UTSW	17	73898335	missense	probably damaging	1.00
R4896:Xdh	UTSW	17	73910243	missense	probably damaging	0.96
R4897:Xdh	UTSW	17	73900708	missense	probably benign
R4923:Xdh	UTSW	17	73924936	missense	possibly damaging	0.72
R4977:Xdh	UTSW	17	73898970	missense	probably benign	0.05
R5030:Xdh	UTSW	17	73891293	missense	probably damaging	1.00
R5185:Xdh	UTSW	17	73925011	missense	probably damaging	1.00
R5347:Xdh	UTSW	17	73925032	missense	probably benign
R5556:Xdh	UTSW	17	73897764	missense	probably benign	0.21
R5566:Xdh	UTSW	17	73893622	missense	probably damaging	1.00
R5568:Xdh	UTSW	17	73943885	missense	possibly damaging	0.90
R5635:Xdh	UTSW	17	73913875	missense	possibly damaging	0.92
R5662:Xdh	UTSW	17	73941115	missense	probably damaging	0.99
R5955:Xdh	UTSW	17	73898320	missense	probably damaging	1.00
R6058:Xdh	UTSW	17	73906269	missense	probably damaging	1.00
R6061:Xdh	UTSW	17	73921347	missense	probably damaging	1.00
R6412:Xdh	UTSW	17	73935907	missense	probably benign	0.09
R6526:Xdh	UTSW	17	73900551	missense	probably damaging	0.97
R6558:Xdh	UTSW	17	73893713	missense	possibly damaging	0.95
R6843:Xdh	UTSW	17	73923130	missense	probably damaging	1.00
R6932:Xdh	UTSW	17	73922562	missense	probably damaging	0.99
R7028:Xdh	UTSW	17	73943873	missense	probably damaging	0.99
R7418:Xdh	UTSW	17	73913965	missense	possibly damaging	0.81
R7503:Xdh	UTSW	17	73926210	missense	probably damaging	1.00
R7653:Xdh	UTSW	17	73897045	missense	probably benign	0.10
R7763:Xdh	UTSW	17	73934834	missense	possibly damaging	0.69
R7768:Xdh	UTSW	17	73939836	missense	probably benign
R7904:Xdh	UTSW	17	73922472	missense	probably benign	0.09
R8010:Xdh	UTSW	17	73909317	nonsense	probably null
R8067:Xdh	UTSW	17	73900657	missense	probably benign	0.01
R8238:Xdh	UTSW	17	73886417	missense	probably benign
R8253:Xdh	UTSW	17	73918382	missense	possibly damaging	0.94
R8346:Xdh	UTSW	17	73913943	missense	probably damaging	1.00
R8350:Xdh	UTSW	17	73934842	missense	probably damaging	1.00
R8381:Xdh	UTSW	17	73912461	missense	probably benign
R8427:Xdh	UTSW	17	73935931	missense	probably damaging	1.00
R8465:Xdh	UTSW	17	73899012	nonsense	probably null
R8478:Xdh	UTSW	17	73906058	missense	probably benign	0.00
R8680:Xdh	UTSW	17	73922505	missense	probably benign
R8802:Xdh	UTSW	17	73918410	missense	probably benign	0.00
R8984:Xdh	UTSW	17	73921351	missense	probably damaging	1.00
R8985:Xdh	UTSW	17	73921351	missense	probably damaging	1.00
R8995:Xdh	UTSW	17	73898374	missense	probably damaging	1.00
R9035:Xdh	UTSW	17	73910227	missense	probably benign
R9149:Xdh	UTSW	17	73915693	missense	probably benign
R9181:Xdh	UTSW	17	73925011	missense	probably damaging	1.00
R9357:Xdh	UTSW	17	73907716	missense	probably damaging	0.97
R9357:Xdh	UTSW	17	73926546	critical splice donor site	probably null
R9609:Xdh	UTSW	17	73924995	missense	possibly damaging	0.91
R9803:Xdh	UTSW	17	73922460	missense	probably benign
X0019:Xdh	UTSW	17	73918454	missense	probably damaging	1.00
Z1088:Xdh	UTSW	17	73886428	missense	probably benign
Z1176:Xdh	UTSW	17	73923042	critical splice donor site	probably null
Z1177:Xdh	UTSW	17	73897695	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGACAGTGAAGCACCTTCCCTTCC -3'
(R):5'- GAAACCGTGTCCTCAGAAGCTCAG -3'

Sequencing Primer
(F):5'- GCAAAAGGATTCATTGTTAGCCC -3'
(R):5'- TCAGAAGCTCAGCCAGACTG -3'

Posted On

2014-04-13