Incidental Mutation 'R0592:Olfr715'
ID172366
Institutional Source Beutler Lab
Gene Symbol Olfr715
Ensembl Gene ENSMUSG00000060503
Gene Nameolfactory receptor 715
SynonymsMOR260-1, GA_x6K02T2PBJ9-9479517-9478573
MMRRC Submission 038782-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.254) question?
Stock #R0592 (G1)
Quality Score43
Status Validated
Chromosome7
Chromosomal Location107125267-107131083 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 107129343 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 17 (L17F)
Ref Sequence ENSEMBL: ENSMUSP00000150168 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076958] [ENSMUST00000214919]
Predicted Effect probably benign
Transcript: ENSMUST00000076958
AA Change: L17F

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000076225
Gene: ENSMUSG00000060503
AA Change: L17F

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 1.6e-57 PFAM
Pfam:7TM_GPCR_Srsx 35 222 1.4e-8 PFAM
Pfam:7tm_1 41 288 1.7e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210247
Predicted Effect probably benign
Transcript: ENSMUST00000214919
AA Change: L17F

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
Meta Mutation Damage Score 0.1553 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg2a GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC 19: 6,245,007 probably benign Het
Bbs7 A T 3: 36,610,297 V53D probably benign Het
Bglap T A 3: 88,383,655 I90F probably benign Het
C2cd4b G A 9: 67,760,691 R323H probably damaging Het
Cdh5 T A 8: 104,130,902 probably null Het
Cdh8 T A 8: 99,279,478 D159V probably damaging Het
Dnah7a A G 1: 53,456,612 Y3229H possibly damaging Het
Dzip1 T C 14: 118,902,139 E381G probably damaging Het
Elmod1 A G 9: 53,926,106 probably benign Het
Exosc10 T C 4: 148,581,113 S811P probably benign Het
Fhl3 A G 4: 124,705,677 Y15C probably benign Het
Gstz1 G A 12: 87,163,721 S126N probably benign Het
Hey2 C A 10: 30,833,957 A267S probably benign Het
Iqce A T 5: 140,686,107 probably null Het
Katnal2 A T 18: 77,002,560 probably null Het
Kdm2b G A 5: 122,961,134 probably benign Het
Mov10l1 A G 15: 88,998,766 probably null Het
Numa1 A G 7: 102,013,897 T724A probably benign Het
Oas3 A G 5: 120,771,149 F244S probably damaging Het
Olfr1472 T C 19: 13,453,705 I271V probably benign Het
Ppil2 A G 16: 17,107,219 S30P probably benign Het
Rab37 T G 11: 115,160,523 probably benign Het
Riox2 T C 16: 59,489,579 probably benign Het
Ryr3 A G 2: 112,678,481 S3358P probably damaging Het
Sash1 T A 10: 8,729,782 H948L probably benign Het
Serpinb6e T A 13: 33,841,074 N78I probably damaging Het
Slc25a47 G A 12: 108,854,258 V63M probably damaging Het
Slc9b1 A T 3: 135,394,074 probably benign Het
Strip2 T A 6: 29,931,210 S387T probably benign Het
Tcaf3 T C 6: 42,596,843 N145S probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Trmu T C 15: 85,896,826 probably benign Het
Vezf1 A T 11: 88,068,435 probably benign Het
Vmn2r116 C T 17: 23,386,915 T267I probably damaging Het
Whrn C A 4: 63,415,567 A450S probably damaging Het
Other mutations in Olfr715
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Olfr715 APN 7 107129065 nonsense probably null
IGL02238:Olfr715 APN 7 107129037 missense probably damaging 1.00
H8562:Olfr715 UTSW 7 107129241 missense probably benign 0.00
PIT4810001:Olfr715 UTSW 7 107128559 missense probably benign 0.11
R0440:Olfr715 UTSW 7 107128732 missense probably benign 0.03
R1051:Olfr715 UTSW 7 107128916 missense possibly damaging 0.94
R1959:Olfr715 UTSW 7 107128510 missense possibly damaging 0.76
R4237:Olfr715 UTSW 7 107129037 missense probably damaging 1.00
R4985:Olfr715 UTSW 7 107129027 missense probably damaging 1.00
R4994:Olfr715 UTSW 7 107129064 missense probably benign 0.03
R6376:Olfr715 UTSW 7 107128641 missense probably benign 0.39
R6931:Olfr715 UTSW 7 107128901 missense probably damaging 1.00
R7593:Olfr715 UTSW 7 107128575 missense probably damaging 1.00
R7718:Olfr715 UTSW 7 107128718 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGGATACACACCCTCCATGTC -3'
(R):5'- AGCACTGTAAATGCCCCAAGTCTC -3'

Sequencing Primer
(F):5'- GCTGCACAGCGTCTAAATG -3'
(R):5'- GACACATCCGTGTTCATAGATGAA -3'
Posted On2014-04-14