Mutagenetix > Incidental Mutation

Incidental Mutation 'R0592:Sash1'

172368

Institutional Source

Beutler Lab

Gene Symbol

Sash1

Ensembl Gene

ENSMUSG00000015305

Gene Name

SAM and SH3 domain containing 1

Synonyms

A330076K04Rik, 2500002E12Rik, 1100001C18Rik

MMRRC Submission

038782-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0592 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

8597983-8761814 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 8605546 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 948 (H948L)

Ref Sequence

ENSEMBL: ENSMUSP00000015449 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015449]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000015449
AA Change: H948L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000015449
Gene: ENSMUSG00000015305
AA Change: H948L

Domain	Start	End	E-Value	Type
low complexity region	2	21	N/A	INTRINSIC
coiled coil region	185	212	N/A	INTRINSIC
low complexity region	323	336	N/A	INTRINSIC
Pfam:SLY	394	548	1.2e-46	PFAM
SH3	550	607	1.16e-3	SMART
SAM	623	690	1.83e-11	SMART
low complexity region	1008	1021	N/A	INTRINSIC
SAM	1157	1224	3.6e-10	SMART

Meta Mutation Damage Score

0.0788

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.5%
20x: 95.0%

Validation Efficiency

100% (35/35)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a scaffold protein involved in the TLR4 signaling pathway that may stimulate cytokine production and endothelial cell migration in response to invading pathogens. The encoded protein has also been described as a potential tumor suppressor that may negatively regulate proliferation, apoptosis, and invasion of cancer cells, and reduced expression of this gene has been observed in multiple human cancers. Mutations in this gene may be associated with abnormal skin pigmentation in human patients. [provided by RefSeq, Oct 2016]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atg2a	GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC	GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC	19: 6,295,037 (GRCm39)		probably benign	Het
Bbs7	A	T	3: 36,664,446 (GRCm39)	V53D	probably benign	Het
Bglap	T	A	3: 88,290,962 (GRCm39)	I90F	probably benign	Het
C2cd4b	G	A	9: 67,667,973 (GRCm39)	R323H	probably damaging	Het
Cdh5	T	A	8: 104,857,534 (GRCm39)		probably null	Het
Cdh8	T	A	8: 100,006,110 (GRCm39)	D159V	probably damaging	Het
Dnah7a	A	G	1: 53,495,771 (GRCm39)	Y3229H	possibly damaging	Het
Dzip1	T	C	14: 119,139,551 (GRCm39)	E381G	probably damaging	Het
Elmod1	A	G	9: 53,833,390 (GRCm39)		probably benign	Het
Exosc10	T	C	4: 148,665,570 (GRCm39)	S811P	probably benign	Het
Fhl3	A	G	4: 124,599,470 (GRCm39)	Y15C	probably benign	Het
Gstz1	G	A	12: 87,210,495 (GRCm39)	S126N	probably benign	Het
Hey2	C	A	10: 30,709,953 (GRCm39)	A267S	probably benign	Het
Iqce	A	T	5: 140,671,862 (GRCm39)		probably null	Het
Katnal2	A	T	18: 77,090,256 (GRCm39)		probably null	Het
Kdm2b	G	A	5: 123,099,197 (GRCm39)		probably benign	Het
Mov10l1	A	G	15: 88,882,969 (GRCm39)		probably null	Het
Numa1	A	G	7: 101,663,104 (GRCm39)	T724A	probably benign	Het
Oas3	A	G	5: 120,909,214 (GRCm39)	F244S	probably damaging	Het
Or2d2	G	A	7: 106,728,550 (GRCm39)	L17F	probably benign	Het
Or5b117	T	C	19: 13,431,069 (GRCm39)	I271V	probably benign	Het
Rab37	T	G	11: 115,051,349 (GRCm39)		probably benign	Het
Riox2	T	C	16: 59,309,942 (GRCm39)		probably benign	Het
Ryr3	A	G	2: 112,508,826 (GRCm39)	S3358P	probably damaging	Het
Serpinb6e	T	A	13: 34,025,057 (GRCm39)	N78I	probably damaging	Het
Slc25a47	G	A	12: 108,820,184 (GRCm39)	V63M	probably damaging	Het
Slc9b1	A	T	3: 135,099,835 (GRCm39)		probably benign	Het
Strip2	T	A	6: 29,931,209 (GRCm39)	S387T	probably benign	Het
Tcaf3	T	C	6: 42,573,777 (GRCm39)	N145S	probably benign	Het
Tex10	C	T	4: 48,456,800 (GRCm39)	R637Q	probably benign	Het
Trmu	T	C	15: 85,781,027 (GRCm39)		probably benign	Het
Vezf1	A	T	11: 88,068,435 (GRCm38)		probably benign	Het
Vmn2r116	C	T	17: 23,605,889 (GRCm39)	T267I	probably damaging	Het
Whrn	C	A	4: 63,333,804 (GRCm39)	A450S	probably damaging	Het
Ypel1	A	G	16: 16,925,083 (GRCm39)	S30P	probably benign	Het

Other mutations in Sash1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00987:Sash1	APN	10	8,627,177 (GRCm39)	missense	probably damaging	1.00
IGL01535:Sash1	APN	10	8,617,341 (GRCm39)	missense	probably damaging	1.00
IGL01537:Sash1	APN	10	8,605,422 (GRCm39)	missense	probably damaging	1.00
IGL01788:Sash1	APN	10	8,609,410 (GRCm39)	missense	probably benign	0.01
IGL01933:Sash1	APN	10	8,626,897 (GRCm39)	missense	probably damaging	0.99
IGL02126:Sash1	APN	10	8,615,229 (GRCm39)	missense	probably damaging	0.96
IGL02285:Sash1	APN	10	8,616,098 (GRCm39)	missense	probably damaging	0.99
IGL02400:Sash1	APN	10	8,609,411 (GRCm39)	nonsense	probably null
IGL02504:Sash1	APN	10	8,605,676 (GRCm39)	missense	probably benign	0.00
IGL02630:Sash1	APN	10	8,620,299 (GRCm39)	missense	probably benign	0.06
boyscout	UTSW	10	8,618,186 (GRCm39)	splice site	probably null
cubscout	UTSW	10	8,605,477 (GRCm39)	missense	probably benign	0.01
R0647:Sash1	UTSW	10	8,605,316 (GRCm39)	missense	probably damaging	0.99
R0656:Sash1	UTSW	10	8,626,901 (GRCm39)	critical splice donor site	probably null
R0830:Sash1	UTSW	10	8,605,673 (GRCm39)	missense	probably benign	0.01
R0919:Sash1	UTSW	10	8,605,843 (GRCm39)	missense	probably benign	0.01
R1470:Sash1	UTSW	10	8,665,357 (GRCm39)	missense	probably damaging	1.00
R1470:Sash1	UTSW	10	8,665,357 (GRCm39)	missense	probably damaging	1.00
R1606:Sash1	UTSW	10	8,605,721 (GRCm39)	missense	probably benign	0.00
R1707:Sash1	UTSW	10	8,606,141 (GRCm39)	missense	probably benign	0.00
R1922:Sash1	UTSW	10	8,603,672 (GRCm39)	missense	possibly damaging	0.62
R1940:Sash1	UTSW	10	8,605,696 (GRCm39)	missense	probably benign
R1964:Sash1	UTSW	10	8,605,477 (GRCm39)	missense	probably benign	0.01
R2013:Sash1	UTSW	10	8,605,177 (GRCm39)	missense	probably benign	0.03
R2014:Sash1	UTSW	10	8,605,177 (GRCm39)	missense	probably benign	0.03
R2015:Sash1	UTSW	10	8,605,177 (GRCm39)	missense	probably benign	0.03
R2074:Sash1	UTSW	10	8,632,461 (GRCm39)	missense	probably damaging	1.00
R2252:Sash1	UTSW	10	8,605,741 (GRCm39)	missense	probably benign	0.01
R2253:Sash1	UTSW	10	8,605,741 (GRCm39)	missense	probably benign	0.01
R2260:Sash1	UTSW	10	8,662,142 (GRCm39)	nonsense	probably null
R3085:Sash1	UTSW	10	8,618,186 (GRCm39)	splice site	probably null
R4024:Sash1	UTSW	10	8,605,681 (GRCm39)	missense	probably benign	0.00
R4039:Sash1	UTSW	10	8,605,391 (GRCm39)	missense	probably damaging	1.00
R4290:Sash1	UTSW	10	8,606,006 (GRCm39)	missense	possibly damaging	0.59
R4292:Sash1	UTSW	10	8,606,006 (GRCm39)	missense	possibly damaging	0.59
R4295:Sash1	UTSW	10	8,606,006 (GRCm39)	missense	possibly damaging	0.59
R4301:Sash1	UTSW	10	8,627,234 (GRCm39)	missense	probably benign	0.00
R4657:Sash1	UTSW	10	8,601,424 (GRCm39)	missense	probably damaging	1.00
R4669:Sash1	UTSW	10	8,606,149 (GRCm39)	missense	probably benign	0.00
R4719:Sash1	UTSW	10	8,605,477 (GRCm39)	missense	probably benign	0.01
R4745:Sash1	UTSW	10	8,605,672 (GRCm39)	missense	probably benign
R5197:Sash1	UTSW	10	8,615,989 (GRCm39)	missense	probably damaging	1.00
R5217:Sash1	UTSW	10	8,656,368 (GRCm39)	missense	possibly damaging	0.63
R5420:Sash1	UTSW	10	8,621,950 (GRCm39)	missense	probably damaging	1.00
R5591:Sash1	UTSW	10	8,601,482 (GRCm39)	missense	probably benign	0.36
R6505:Sash1	UTSW	10	8,605,291 (GRCm39)	missense	probably benign	0.21
R6679:Sash1	UTSW	10	8,615,949 (GRCm39)	missense	probably damaging	1.00
R6761:Sash1	UTSW	10	8,620,286 (GRCm39)	missense	probably damaging	0.99
R6885:Sash1	UTSW	10	8,659,985 (GRCm39)	missense	probably damaging	1.00
R6980:Sash1	UTSW	10	8,605,612 (GRCm39)	missense	probably benign	0.00
R7034:Sash1	UTSW	10	8,605,847 (GRCm39)	nonsense	probably null
R7036:Sash1	UTSW	10	8,605,847 (GRCm39)	nonsense	probably null
R7088:Sash1	UTSW	10	8,605,481 (GRCm39)	nonsense	probably null
R7289:Sash1	UTSW	10	8,605,960 (GRCm39)	missense	probably damaging	0.99
R7464:Sash1	UTSW	10	8,632,509 (GRCm39)	missense	possibly damaging	0.82
R7661:Sash1	UTSW	10	8,605,155 (GRCm39)	missense	probably benign	0.01
R7752:Sash1	UTSW	10	8,656,328 (GRCm39)	nonsense	probably null
R7856:Sash1	UTSW	10	8,605,472 (GRCm39)	missense	probably benign	0.00
R7901:Sash1	UTSW	10	8,656,328 (GRCm39)	nonsense	probably null
R8152:Sash1	UTSW	10	8,626,805 (GRCm39)	missense	possibly damaging	0.94
R8218:Sash1	UTSW	10	8,627,000 (GRCm39)	missense	probably damaging	0.99
R8317:Sash1	UTSW	10	8,605,150 (GRCm39)	missense	possibly damaging	0.76
R8358:Sash1	UTSW	10	8,605,745 (GRCm39)	missense	probably benign
R8503:Sash1	UTSW	10	8,656,277 (GRCm39)	splice site	probably benign
R8696:Sash1	UTSW	10	8,609,459 (GRCm39)	missense	probably damaging	1.00
R8703:Sash1	UTSW	10	8,605,595 (GRCm39)	missense	probably damaging	0.99
R8710:Sash1	UTSW	10	8,656,285 (GRCm39)	missense	possibly damaging	0.82
R8822:Sash1	UTSW	10	8,761,615 (GRCm39)	start gained	probably benign
R8826:Sash1	UTSW	10	8,637,869 (GRCm39)	start codon destroyed	probably null
R8891:Sash1	UTSW	10	8,603,734 (GRCm39)	missense	probably damaging	1.00
R8968:Sash1	UTSW	10	8,606,179 (GRCm39)	missense	probably benign	0.00
R8984:Sash1	UTSW	10	8,626,808 (GRCm39)	missense	possibly damaging	0.46
R9194:Sash1	UTSW	10	8,615,969 (GRCm39)	missense	probably damaging	0.99
R9248:Sash1	UTSW	10	8,617,296 (GRCm39)	missense	probably damaging	1.00
R9405:Sash1	UTSW	10	8,637,994 (GRCm39)	start gained	probably benign
R9408:Sash1	UTSW	10	8,637,994 (GRCm39)	start gained	probably benign
R9489:Sash1	UTSW	10	8,605,169 (GRCm39)	missense	probably benign	0.05
R9576:Sash1	UTSW	10	8,620,299 (GRCm39)	missense	probably benign	0.06
R9632:Sash1	UTSW	10	8,615,969 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCTCAGTGAGATCAATGCCCTCC -3'
(R):5'- CAGCAGATGTGATGCTTCTGACCC -3'

Sequencing Primer
(F):5'- GTGAGCATCTCTAGGTCCACAC -3'
(R):5'- CTTCTGACCCAAAGCAAGAGATTTTC -3'

Posted On

2014-04-14