Incidental Mutation 'R0226:Mrm1'
ID172382
Institutional Source Beutler Lab
Gene Symbol Mrm1
Ensembl Gene ENSMUSG00000018405
Gene Namemitochondrial rRNA methyltransferase 1
Synonyms
MMRRC Submission 038471-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R0226 (G1)
Quality Score74
Status Validated
Chromosome11
Chromosomal Location84813061-84819515 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 84819170 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 68 (A68V)
Ref Sequence ENSEMBL: ENSMUSP00000018549 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018549] [ENSMUST00000047560] [ENSMUST00000151496]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018549
AA Change: A68V

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000018549
Gene: ENSMUSG00000018405
AA Change: A68V

DomainStartEndE-ValueType
SpoU_sub_bind 49 127 3.31e-11 SMART
Pfam:SpoU_methylase 143 299 3.2e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000047560
SMART Domains Protein: ENSMUSP00000043467
Gene: ENSMUSG00000034449

DomainStartEndE-ValueType
Pfam:adh_short 12 214 1.4e-46 PFAM
Pfam:KR 13 154 1.7e-11 PFAM
Pfam:Epimerase 14 251 4.8e-7 PFAM
Pfam:adh_short_C2 18 245 1.8e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139076
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144104
Predicted Effect probably benign
Transcript: ENSMUST00000151496
SMART Domains Protein: ENSMUSP00000122267
Gene: ENSMUSG00000034449

DomainStartEndE-ValueType
Pfam:adh_short 12 49 6.3e-8 PFAM
Meta Mutation Damage Score 0.0741 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency 100% (98/98)
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G T 14: 59,142,120 T54K possibly damaging Het
2210408I21Rik A T 13: 77,303,425 E876V possibly damaging Het
Aasdh A T 5: 76,902,002 L49Q probably damaging Het
Abca8b T C 11: 109,957,018 probably null Het
Ablim1 A T 19: 57,043,870 L556Q probably damaging Het
Afdn A G 17: 13,899,146 T1700A probably benign Het
Agl G A 3: 116,752,071 R1359C probably damaging Het
Agpat3 T A 10: 78,278,029 H275L possibly damaging Het
Ahcyl1 A T 3: 107,670,270 C180* probably null Het
Aim2 A G 1: 173,462,333 probably benign Het
Angpt1 T C 15: 42,468,235 N320S probably benign Het
Ankrd52 T A 10: 128,389,858 probably null Het
Ap1g1 C T 8: 109,855,062 S654L probably benign Het
Bpifa1 T A 2: 154,146,057 S173R probably benign Het
Brd8 T C 18: 34,603,894 probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
C1qtnf2 A G 11: 43,490,843 T161A probably benign Het
Car6 T C 4: 150,187,508 Y228C probably damaging Het
Ccdc149 A G 5: 52,400,217 L273P probably damaging Het
Cit G A 5: 115,984,840 R1405Q probably damaging Het
Cox17 T C 16: 38,349,276 L48P probably damaging Het
Cttn A G 7: 144,441,852 probably benign Het
Cyp4f18 T C 8: 71,989,775 probably benign Het
Dtnbp1 A G 13: 44,923,193 L175P probably damaging Het
Efl1 T C 7: 82,693,011 probably benign Het
Fbn1 C T 2: 125,320,910 R2152Q possibly damaging Het
Fignl1 A T 11: 11,801,061 S665T probably benign Het
Gm884 A T 11: 103,603,241 F663L probably benign Het
Gm9843 A T 16: 76,403,561 noncoding transcript Het
Gpr155 C T 2: 73,367,592 V395I probably benign Het
Greb1l T C 18: 10,522,076 probably benign Het
Hdgfl1 A T 13: 26,769,996 H31Q probably benign Het
Heatr1 T C 13: 12,410,562 S628P probably damaging Het
Hivep2 A G 10: 14,129,712 T685A probably benign Het
Hmgcl T G 4: 135,958,728 V168G probably damaging Het
Itch T C 2: 155,199,394 I454T probably benign Het
Itih2 T C 2: 10,115,299 D309G possibly damaging Het
Kcmf1 T C 6: 72,842,952 I304V probably benign Het
Kcnh1 G A 1: 192,276,804 W222* probably null Het
Kcnh1 G T 1: 192,276,805 W222C probably damaging Het
Kif24 T A 4: 41,414,939 K287* probably null Het
Lrig3 A G 10: 125,972,117 probably benign Het
Lrp2 A T 2: 69,537,563 C202S probably null Het
Lrrn2 A G 1: 132,937,820 N208D probably damaging Het
Mcm5 C T 8: 75,126,252 T664I possibly damaging Het
Mfsd10 A G 5: 34,634,446 L365S probably benign Het
Mfsd6 A G 1: 52,658,690 probably benign Het
Mgat4e A G 1: 134,541,103 V401A probably benign Het
Mllt3 C A 4: 87,840,732 V360L probably benign Het
Myo19 A G 11: 84,897,732 probably benign Het
Myo3b A G 2: 70,217,166 T311A probably benign Het
Myo5b T C 18: 74,742,180 F1552L probably benign Het
Myo7b C T 18: 31,972,896 V1353I probably benign Het
Myo9b T C 8: 71,353,832 S1512P probably damaging Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Osbpl3 A G 6: 50,353,008 W63R probably damaging Het
Pcdh17 T C 14: 84,448,201 S703P probably damaging Het
Pclo T C 5: 14,765,223 I1231T probably damaging Het
Pex16 A C 2: 92,375,687 probably benign Het
Pfkl T C 10: 77,992,534 N399S probably benign Het
Pkhd1l1 G A 15: 44,526,784 R1432K possibly damaging Het
Prdm1 T A 10: 44,456,696 T106S probably benign Het
Prrc1 A G 18: 57,363,291 M105V probably benign Het
Psg26 A G 7: 18,483,958 C12R possibly damaging Het
Rnf43 A T 11: 87,731,437 S455C probably damaging Het
Ryr2 T C 13: 11,772,556 K977R probably damaging Het
Sart1 C T 19: 5,381,122 probably benign Het
Sec14l5 A G 16: 5,180,303 S509G probably benign Het
Sin3b A T 8: 72,744,508 E361V probably benign Het
Slc35e3 C T 10: 117,740,890 E179K possibly damaging Het
Sntb2 T C 8: 107,001,583 S388P probably damaging Het
Srms A G 2: 181,212,382 S131P probably benign Het
Stxbp5 T C 10: 9,866,698 probably benign Het
Taar2 T C 10: 23,941,063 V167A probably damaging Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Thsd7a A G 6: 12,321,900 Y1516H possibly damaging Het
Tlk1 T A 2: 70,714,169 probably benign Het
Tmem173 A T 18: 35,739,088 F120L probably benign Het
Tnfaip3 T C 10: 19,002,747 K771R probably damaging Het
Treml1 C T 17: 48,360,458 L124F probably damaging Het
Ttn G T 2: 76,780,797 Q9137K possibly damaging Het
Unkl T A 17: 25,230,711 I469N probably damaging Het
Vmn1r173 G T 7: 23,703,083 V248L possibly damaging Het
Vps35 T C 8: 85,273,575 Q474R probably damaging Het
Wdr17 T A 8: 54,663,008 T580S probably benign Het
Xpnpep1 T C 19: 53,010,152 K222E probably benign Het
Ylpm1 A G 12: 85,049,737 T1446A probably benign Het
Zfp277 A G 12: 40,364,162 L228S possibly damaging Het
Zfp941 T A 7: 140,813,275 K57M probably damaging Het
Zmpste24 A T 4: 121,081,209 S244R probably benign Het
Other mutations in Mrm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0257:Mrm1 UTSW 11 84814823 splice site probably benign
R0381:Mrm1 UTSW 11 84818683 missense possibly damaging 0.91
R0563:Mrm1 UTSW 11 84814713 missense probably damaging 1.00
R0715:Mrm1 UTSW 11 84814813 splice site probably benign
R1710:Mrm1 UTSW 11 84818692 missense probably damaging 1.00
R4402:Mrm1 UTSW 11 84819089 missense probably damaging 1.00
R4413:Mrm1 UTSW 11 84819228 missense possibly damaging 0.46
R5266:Mrm1 UTSW 11 84819260 missense possibly damaging 0.58
R5930:Mrm1 UTSW 11 84819192 missense probably damaging 1.00
R7833:Mrm1 UTSW 11 84818643 missense probably damaging 1.00
X0017:Mrm1 UTSW 11 84814923 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TCTGTCTACGCCGAGGAAGTGAG -3'
(R):5'- GTGCTTCAGTCGCCTGATTGCC -3'

Sequencing Primer
(F):5'- ATCCTGGAGCCCCTCAAG -3'
(R):5'- CTGATTGCCCGCCATTTC -3'
Posted On2014-04-22