Incidental Mutation 'R0003:Fcho1'
ID 172387
Institutional Source Beutler Lab
Gene Symbol Fcho1
Ensembl Gene ENSMUSG00000070000
Gene Name FCH domain only 1
Synonyms 3322402E17Rik
MMRRC Submission 038299-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.259) question?
Stock # R0003 (G1)
Quality Score 73
Status Validated
Chromosome 8
Chromosomal Location 72161031-72178360 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 72161597 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 858 (S858T)
Ref Sequence ENSEMBL: ENSMUSP00000117606 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093444] [ENSMUST00000136640] [ENSMUST00000146100]
AlphaFold Q8K285
Predicted Effect probably damaging
Transcript: ENSMUST00000093444
AA Change: S858T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091151
Gene: ENSMUSG00000070000
AA Change: S858T

DomainStartEndE-ValueType
FCH 6 92 2.05e-21 SMART
low complexity region 334 351 N/A INTRINSIC
low complexity region 364 382 N/A INTRINSIC
low complexity region 446 466 N/A INTRINSIC
low complexity region 567 576 N/A INTRINSIC
Pfam:muHD 610 872 4.9e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123425
SMART Domains Protein: ENSMUSP00000123631
Gene: ENSMUSG00000070000

DomainStartEndE-ValueType
low complexity region 52 70 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127005
Predicted Effect probably benign
Transcript: ENSMUST00000136640
SMART Domains Protein: ENSMUSP00000119273
Gene: ENSMUSG00000070000

DomainStartEndE-ValueType
FCH 6 92 2.05e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143699
Predicted Effect probably damaging
Transcript: ENSMUST00000146100
AA Change: S858T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117606
Gene: ENSMUSG00000070000
AA Change: S858T

DomainStartEndE-ValueType
FCH 6 92 2.05e-21 SMART
low complexity region 334 351 N/A INTRINSIC
low complexity region 364 382 N/A INTRINSIC
low complexity region 446 466 N/A INTRINSIC
low complexity region 567 576 N/A INTRINSIC
Pfam:muHD 610 872 1.4e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212029
Meta Mutation Damage Score 0.2894 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.7%
Validation Efficiency 94% (82/87)
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 T A 11: 46,019,616 (GRCm39) C439S probably damaging Het
Adnp2 T C 18: 80,174,205 (GRCm39) Y68C probably damaging Het
Ahctf1 A T 1: 179,591,038 (GRCm39) D1247E probably benign Het
Alms1 T A 6: 85,606,192 (GRCm39) M2614K possibly damaging Het
Alx3 A G 3: 107,512,292 (GRCm39) H310R probably damaging Het
Ambra1 C T 2: 91,741,773 (GRCm39) T1016M probably damaging Het
Ankrd35 A G 3: 96,591,331 (GRCm39) E539G probably damaging Het
Aptx A G 4: 40,695,145 (GRCm39) probably benign Het
Arsi C T 18: 61,050,058 (GRCm39) R314C probably benign Het
Atp1a3 T C 7: 24,688,989 (GRCm39) probably benign Het
Avl9 G T 6: 56,713,468 (GRCm39) R242L probably benign Het
Bicra G T 7: 15,705,812 (GRCm39) T1543K probably benign Het
Bltp2 T A 11: 78,177,404 (GRCm39) V1903E possibly damaging Het
Bzw2 A C 12: 36,180,014 (GRCm39) I71S probably damaging Het
Camk2a C T 18: 61,093,079 (GRCm39) A302V probably damaging Het
Ccdc12 A G 9: 110,485,665 (GRCm39) E12G possibly damaging Het
Cd300lb A T 11: 114,819,164 (GRCm39) F19Y probably benign Het
Clcn3 A T 8: 61,380,330 (GRCm39) C535* probably null Het
Cntnap5c A G 17: 58,506,012 (GRCm39) T679A probably benign Het
Cpsf7 G A 19: 10,516,993 (GRCm39) S365N possibly damaging Het
Cspg4b T A 13: 113,505,310 (GRCm39) S2146R probably benign Het
Cyp20a1 T C 1: 60,426,285 (GRCm39) probably benign Het
Decr2 A T 17: 26,302,027 (GRCm39) N234K probably benign Het
Def8 G A 8: 124,183,234 (GRCm39) A278T probably damaging Het
Dnah12 T C 14: 26,494,601 (GRCm39) F1300L probably damaging Het
Dock1 T C 7: 134,331,793 (GRCm39) probably benign Het
Dpy19l4 A T 4: 11,267,619 (GRCm39) N440K probably damaging Het
Eprs1 T C 1: 185,146,588 (GRCm39) V1206A probably damaging Het
Exoc6b A G 6: 84,831,681 (GRCm39) probably null Het
Fam184b A G 5: 45,712,536 (GRCm39) probably benign Het
Fgfr1 A G 8: 26,058,214 (GRCm39) D430G possibly damaging Het
Fmnl3 T C 15: 99,219,013 (GRCm39) T807A probably damaging Het
Gabra5 T C 7: 57,063,476 (GRCm39) Y316C probably damaging Het
Gh A G 11: 106,192,346 (GRCm39) L16P probably damaging Het
Glipr2 A T 4: 43,970,532 (GRCm39) I87F probably damaging Het
Glrb T A 3: 80,763,221 (GRCm39) I259F probably damaging Het
Gpr63 T C 4: 25,007,651 (GRCm39) L125P probably damaging Het
Grb2 A G 11: 115,546,251 (GRCm39) Y37H probably damaging Het
Haus2 G A 2: 120,449,449 (GRCm39) probably benign Het
Hmgcr T C 13: 96,788,653 (GRCm39) N749S probably damaging Het
Igf1r T C 7: 67,814,990 (GRCm39) V297A probably damaging Het
Il12rb2 G T 6: 67,293,270 (GRCm39) P69H probably damaging Het
Ints3 C A 3: 90,315,818 (GRCm39) M315I probably benign Het
Izumo2 C T 7: 44,364,833 (GRCm39) T116I probably benign Het
Kctd19 A C 8: 106,121,993 (GRCm39) Y185D probably damaging Het
Lama4 A G 10: 38,936,218 (GRCm39) N631S possibly damaging Het
Lama5 T G 2: 179,819,872 (GRCm39) probably null Het
Lamc1 A C 1: 153,138,185 (GRCm39) L223R probably damaging Het
Lgr4 G A 2: 109,828,010 (GRCm39) probably null Het
Loxhd1 T C 18: 77,427,196 (GRCm39) L398P probably damaging Het
Mapk9 T A 11: 49,757,866 (GRCm39) D103E possibly damaging Het
Marchf6 T C 15: 31,469,678 (GRCm39) probably benign Het
Mlxipl G A 5: 135,162,043 (GRCm39) probably benign Het
Mrgbp C A 2: 180,225,231 (GRCm39) D62E probably benign Het
Mtap A T 4: 89,070,235 (GRCm39) probably benign Het
Myt1 G A 2: 181,443,664 (GRCm39) G497S probably damaging Het
Naa25 T G 5: 121,545,247 (GRCm39) probably benign Het
Nfat5 C T 8: 108,065,707 (GRCm39) R156W probably damaging Het
Nkpd1 T C 7: 19,253,852 (GRCm39) C73R probably benign Het
Nup210l T C 3: 90,027,218 (GRCm39) I200T probably damaging Het
Nvl C A 1: 180,941,698 (GRCm39) D581Y probably damaging Het
Or51a6 T C 7: 102,604,185 (GRCm39) M208V probably benign Het
Or51f2 T C 7: 102,527,068 (GRCm39) V247A probably benign Het
Or5t17 T A 2: 86,832,710 (GRCm39) Y132* probably null Het
Or8b1c A G 9: 38,384,612 (GRCm39) T190A probably benign Het
Or9q1 T C 19: 13,805,050 (GRCm39) T237A probably damaging Het
Pcdh7 G T 5: 58,070,590 (GRCm39) E1089D probably benign Het
Pik3cd A G 4: 149,740,836 (GRCm39) probably null Het
Plekhh2 A T 17: 84,864,820 (GRCm39) K69N probably damaging Het
Ptgdr2 G A 19: 10,917,792 (GRCm39) C103Y probably damaging Het
Rrad A C 8: 105,355,299 (GRCm39) H236Q probably benign Het
Rslcan18 C T 13: 67,246,533 (GRCm39) A236T probably benign Het
Ryr2 C A 13: 11,839,265 (GRCm39) D503Y probably damaging Het
Siglec1 T C 2: 130,916,980 (GRCm39) T1092A probably benign Het
Siglecf A G 7: 43,005,350 (GRCm39) T437A probably benign Het
Spta1 A T 1: 174,032,839 (GRCm39) Q965H probably damaging Het
Stk10 A T 11: 32,539,460 (GRCm39) E280V probably benign Het
Tfg T C 16: 56,511,351 (GRCm39) Y326C possibly damaging Het
Tpp2 T A 1: 43,999,299 (GRCm39) S358T possibly damaging Het
Trim25 G T 11: 88,906,598 (GRCm39) V437L probably benign Het
Ttn T C 2: 76,574,027 (GRCm39) D25622G probably damaging Het
Ube3b T A 5: 114,536,912 (GRCm39) S303R probably benign Het
Ush2a T A 1: 188,310,688 (GRCm39) V2088D probably damaging Het
Vmn2r103 A G 17: 20,032,241 (GRCm39) T672A probably damaging Het
Wdr11 G T 7: 129,200,785 (GRCm39) G79C probably damaging Het
Wdr89 T A 12: 75,679,367 (GRCm39) T296S probably benign Het
Zdhhc24 T A 19: 4,930,402 (GRCm39) L179M possibly damaging Het
Zfp981 T C 4: 146,622,217 (GRCm39) C381R probably damaging Het
Zim1 A G 7: 6,679,947 (GRCm39) I572T probably benign Het
Other mutations in Fcho1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01021:Fcho1 APN 8 72,166,167 (GRCm39) nonsense probably null
IGL01291:Fcho1 APN 8 72,165,191 (GRCm39) missense probably benign 0.08
IGL01473:Fcho1 APN 8 72,164,782 (GRCm39) missense probably benign 0.03
IGL02021:Fcho1 APN 8 72,173,919 (GRCm39) missense probably benign 0.06
IGL02086:Fcho1 APN 8 72,169,444 (GRCm39) missense probably damaging 1.00
IGL02808:Fcho1 APN 8 72,165,185 (GRCm39) missense possibly damaging 0.89
IGL03146:Fcho1 APN 8 72,170,074 (GRCm39) splice site probably benign
IGL03267:Fcho1 APN 8 72,164,943 (GRCm39) unclassified probably benign
cameo UTSW 8 72,169,507 (GRCm39) missense possibly damaging 0.92
Lesser UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
Sidekick UTSW 8 72,168,369 (GRCm39) missense probably damaging 1.00
ANU05:Fcho1 UTSW 8 72,165,191 (GRCm39) missense probably benign 0.08
R0010:Fcho1 UTSW 8 72,162,643 (GRCm39) missense probably damaging 1.00
R0020:Fcho1 UTSW 8 72,169,514 (GRCm39) missense probably benign 0.11
R0363:Fcho1 UTSW 8 72,170,134 (GRCm39) missense probably damaging 1.00
R0457:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R0485:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R0501:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R0502:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R0551:Fcho1 UTSW 8 72,164,818 (GRCm39) missense probably benign 0.06
R0583:Fcho1 UTSW 8 72,168,369 (GRCm39) missense probably damaging 1.00
R0584:Fcho1 UTSW 8 72,168,369 (GRCm39) missense probably damaging 1.00
R0585:Fcho1 UTSW 8 72,168,369 (GRCm39) missense probably damaging 1.00
R0612:Fcho1 UTSW 8 72,168,168 (GRCm39) missense probably damaging 1.00
R0614:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R0647:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R0841:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R0842:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R1034:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R1036:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R1399:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R1466:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R1466:Fcho1 UTSW 8 72,165,204 (GRCm39) missense probably benign 0.00
R1618:Fcho1 UTSW 8 72,163,047 (GRCm39) missense probably damaging 0.98
R1754:Fcho1 UTSW 8 72,163,890 (GRCm39) missense probably benign
R1793:Fcho1 UTSW 8 72,161,666 (GRCm39) nonsense probably null
R2073:Fcho1 UTSW 8 72,163,133 (GRCm39) missense probably damaging 0.98
R2177:Fcho1 UTSW 8 72,164,905 (GRCm39) missense probably damaging 1.00
R4072:Fcho1 UTSW 8 72,163,013 (GRCm39) missense probably damaging 0.99
R4074:Fcho1 UTSW 8 72,163,013 (GRCm39) missense probably damaging 0.99
R4076:Fcho1 UTSW 8 72,163,013 (GRCm39) missense probably damaging 0.99
R4606:Fcho1 UTSW 8 72,165,124 (GRCm39) missense probably benign
R4732:Fcho1 UTSW 8 72,169,439 (GRCm39) missense probably benign 0.00
R4733:Fcho1 UTSW 8 72,169,439 (GRCm39) missense probably benign 0.00
R4860:Fcho1 UTSW 8 72,163,125 (GRCm39) missense probably benign 0.04
R4860:Fcho1 UTSW 8 72,163,125 (GRCm39) missense probably benign 0.04
R5082:Fcho1 UTSW 8 72,169,829 (GRCm39) missense possibly damaging 0.69
R5083:Fcho1 UTSW 8 72,169,820 (GRCm39) missense probably benign 0.00
R5185:Fcho1 UTSW 8 72,167,600 (GRCm39) unclassified probably benign
R6025:Fcho1 UTSW 8 72,165,217 (GRCm39) splice site probably null
R6624:Fcho1 UTSW 8 72,162,015 (GRCm39) missense probably damaging 0.99
R6875:Fcho1 UTSW 8 72,167,069 (GRCm39) splice site probably null
R7069:Fcho1 UTSW 8 72,163,141 (GRCm39) splice site probably null
R7476:Fcho1 UTSW 8 72,166,190 (GRCm39) missense probably damaging 1.00
R7512:Fcho1 UTSW 8 72,169,507 (GRCm39) missense possibly damaging 0.92
R7951:Fcho1 UTSW 8 72,164,920 (GRCm39) missense probably benign 0.00
R8699:Fcho1 UTSW 8 72,162,277 (GRCm39) missense possibly damaging 0.63
R8938:Fcho1 UTSW 8 72,169,790 (GRCm39) missense possibly damaging 0.96
R9090:Fcho1 UTSW 8 72,163,068 (GRCm39) missense possibly damaging 0.80
R9117:Fcho1 UTSW 8 72,164,712 (GRCm39) missense possibly damaging 0.87
R9119:Fcho1 UTSW 8 72,164,712 (GRCm39) missense possibly damaging 0.87
R9271:Fcho1 UTSW 8 72,163,068 (GRCm39) missense possibly damaging 0.80
R9433:Fcho1 UTSW 8 72,169,468 (GRCm39) missense probably benign 0.03
R9447:Fcho1 UTSW 8 72,169,913 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAATACTAAAGGCCAGGGCCTGC -3'
(R):5'- AGCCTGTGACAAAGAGCCTGTGAC -3'

Sequencing Primer
(F):5'- AAATGGGTGTTCCTGTCCAC -3'
(R):5'- CCTGTGACAGGAGCACATC -3'
Posted On 2014-04-23