Mutagenetix > Incidental Mutation

Incidental Mutation 'R1227:Rasal1'

172407

Institutional Source

Beutler Lab

Gene Symbol

Rasal1

Ensembl Gene

ENSMUSG00000029602

Gene Name

RAS protein activator like 1 (GAP1 like)

Synonyms

MRASAL

MMRRC Submission

039296-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1227 (G1)

Quality Score

141

Status

Not validated

Chromosome

Chromosomal Location

120786877-120817662 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 120808372 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 468 (L468P)

Ref Sequence

ENSEMBL: ENSMUSP00000123266 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031606] [ENSMUST00000156722]

AlphaFold

Q9Z268

Predicted Effect

probably damaging
Transcript: ENSMUST00000031606
AA Change: L468P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000031606
Gene: ENSMUSG00000029602
AA Change: L468P

Domain	Start	End	E-Value	Type
C2	6	113	7.74e-13	SMART
C2	134	231	2e-15	SMART
RasGAP	241	604	3.96e-166	SMART
PH	566	674	2.76e-16	SMART
BTK	674	710	2.24e-4	SMART
low complexity region	731	745	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000156722
AA Change: L468P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000123266
Gene: ENSMUSG00000029602
AA Change: L468P

Domain	Start	End	E-Value	Type
C2	6	113	7.74e-13	SMART
C2	134	231	2e-15	SMART
RasGAP	241	604	3.96e-166	SMART
PH	566	674	2.76e-16	SMART
BTK	674	710	2.24e-4	SMART
low complexity region	731	745	N/A	INTRINSIC

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.5%
20x: 89.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is member of the GAP1 family of GTPase-activating proteins. These proteins stimulate the GTPase activity of normal RAS p21 but not its oncogenic counterpart. Acting as a suppressor of RAS function, the protein enhances the weak intrinsic GTPase activity of RAS proteins resulting in the inactive GDP-bound form of RAS, thereby allowing control of cellular proliferation and differentiation. This particular family member contains domains which are characteristic of the GAP1 subfamily of RasGAP proteins but, in contrast to the other GAP1 family members, this protein is strongly and selectively expressed in endocrine tissues. Alternatively spliced transcript variants that encode different isoforms have been described [provided by RefSeq, Jul 2010]

Allele List at MGI

Other mutations in this stock

Total: 20 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankrd42	T	A	7: 92,254,508 (GRCm39)	H367L	possibly damaging	Het
Arvcf	C	T	16: 18,207,169 (GRCm39)	R43C	probably benign	Het
Camk1g	T	C	1: 193,029,741 (GRCm39)	E453G	possibly damaging	Het
Cmya5	A	T	13: 93,230,954 (GRCm39)	L1378Q	probably damaging	Het
Cplx1	T	C	5: 108,673,262 (GRCm39)	D53G	possibly damaging	Het
Ddx31	A	G	2: 28,747,187 (GRCm39)	E222G	probably damaging	Het
Dync1h1	G	A	12: 110,602,943 (GRCm39)	E2195K	probably benign	Het
Fermt2	A	G	14: 45,697,447 (GRCm39)	S635P	probably benign	Het
Gls2	T	C	10: 128,035,533 (GRCm39)	S104P	probably damaging	Het
Hnrnpul2	T	G	19: 8,800,601 (GRCm39)	S226A	possibly damaging	Het
Klk1b5	T	C	7: 43,496,670 (GRCm39)		probably null	Het
Nuak1	T	A	10: 84,276,173 (GRCm39)	T17S	probably benign	Het
Or5b101	T	C	19: 13,005,217 (GRCm39)	M159V	probably benign	Het
Or5p54	C	A	7: 107,554,259 (GRCm39)	S137Y	probably damaging	Het
Prag1	G	A	8: 36,607,105 (GRCm39)	E949K	probably damaging	Het
Pramel25	A	G	4: 143,520,134 (GRCm39)	H126R	probably benign	Het
Sez6l	C	A	5: 112,621,330 (GRCm39)	C248F	probably damaging	Het
Sstr2	T	C	11: 113,515,711 (GRCm39)	I210T	probably damaging	Het
Tbc1d2	C	T	4: 46,620,629 (GRCm39)	G394S	probably benign	Het
Zfp108	T	A	7: 23,959,885 (GRCm39)	W159R	probably benign	Het

Other mutations in Rasal1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00909:Rasal1	APN	5	120,802,872 (GRCm39)	missense	probably damaging	1.00
IGL01700:Rasal1	APN	5	120,814,882 (GRCm39)	missense	probably benign	0.06
IGL01790:Rasal1	APN	5	120,808,383 (GRCm39)	missense	possibly damaging	0.61
IGL01866:Rasal1	APN	5	120,813,488 (GRCm39)	missense	probably damaging	1.00
IGL02143:Rasal1	APN	5	120,790,917 (GRCm39)	missense	probably damaging	1.00
IGL02527:Rasal1	APN	5	120,804,469 (GRCm39)	missense	probably damaging	0.98
IGL02565:Rasal1	APN	5	120,814,845 (GRCm39)	splice site	probably benign
IGL02710:Rasal1	APN	5	120,804,496 (GRCm39)	missense	possibly damaging	0.71
PIT4618001:Rasal1	UTSW	5	120,808,441 (GRCm39)	missense	probably damaging	0.99
R0270:Rasal1	UTSW	5	120,812,794 (GRCm39)	missense	probably damaging	0.97
R0281:Rasal1	UTSW	5	120,812,670 (GRCm39)	missense	probably benign
R0673:Rasal1	UTSW	5	120,808,449 (GRCm39)	missense	probably benign	0.26
R1475:Rasal1	UTSW	5	120,801,047 (GRCm39)	missense	possibly damaging	0.55
R1486:Rasal1	UTSW	5	120,792,917 (GRCm39)	missense	probably damaging	1.00
R1557:Rasal1	UTSW	5	120,814,914 (GRCm39)	missense	possibly damaging	0.87
R1651:Rasal1	UTSW	5	120,790,910 (GRCm39)	nonsense	probably null
R1792:Rasal1	UTSW	5	120,802,821 (GRCm39)	missense	probably benign	0.06
R2148:Rasal1	UTSW	5	120,800,096 (GRCm39)	missense	probably damaging	0.97
R2964:Rasal1	UTSW	5	120,809,685 (GRCm39)	missense	probably damaging	0.99
R2966:Rasal1	UTSW	5	120,809,685 (GRCm39)	missense	probably damaging	0.99
R2983:Rasal1	UTSW	5	120,792,927 (GRCm39)	missense	probably benign	0.45
R4090:Rasal1	UTSW	5	120,813,674 (GRCm39)	missense	possibly damaging	0.95
R4205:Rasal1	UTSW	5	120,797,628 (GRCm39)	missense	probably benign	0.21
R4643:Rasal1	UTSW	5	120,817,029 (GRCm39)	missense	probably benign	0.05
R4979:Rasal1	UTSW	5	120,816,741 (GRCm39)	missense	probably benign
R5171:Rasal1	UTSW	5	120,801,829 (GRCm39)	missense	probably benign
R5187:Rasal1	UTSW	5	120,813,460 (GRCm39)	missense	probably benign	0.13
R5877:Rasal1	UTSW	5	120,817,135 (GRCm39)	utr 3 prime	probably benign
R5924:Rasal1	UTSW	5	120,813,582 (GRCm39)	missense	probably damaging	1.00
R6037:Rasal1	UTSW	5	120,787,566 (GRCm39)	missense	possibly damaging	0.55
R6037:Rasal1	UTSW	5	120,787,566 (GRCm39)	missense	possibly damaging	0.55
R6136:Rasal1	UTSW	5	120,813,543 (GRCm39)	missense	possibly damaging	0.84
R6159:Rasal1	UTSW	5	120,797,673 (GRCm39)	missense	probably damaging	1.00
R6292:Rasal1	UTSW	5	120,797,685 (GRCm39)	missense	probably damaging	0.97
R6548:Rasal1	UTSW	5	120,812,790 (GRCm39)	missense	probably benign	0.00
R7042:Rasal1	UTSW	5	120,802,025 (GRCm39)	splice site	probably null
R7194:Rasal1	UTSW	5	120,813,557 (GRCm39)	missense	probably benign
R7356:Rasal1	UTSW	5	120,792,890 (GRCm39)	missense	possibly damaging	0.65
R7406:Rasal1	UTSW	5	120,801,002 (GRCm39)	missense	probably benign	0.11
R7662:Rasal1	UTSW	5	120,800,249 (GRCm39)	missense	probably benign	0.36
R8089:Rasal1	UTSW	5	120,809,643 (GRCm39)	missense	probably damaging	1.00
R8320:Rasal1	UTSW	5	120,804,420 (GRCm39)	missense	probably benign	0.01
R8321:Rasal1	UTSW	5	120,804,420 (GRCm39)	missense	probably benign	0.01
R8362:Rasal1	UTSW	5	120,813,485 (GRCm39)	missense	probably damaging	1.00
R8368:Rasal1	UTSW	5	120,809,615 (GRCm39)	missense	probably damaging	1.00
R8379:Rasal1	UTSW	5	120,804,420 (GRCm39)	missense	probably benign	0.01
R8380:Rasal1	UTSW	5	120,804,420 (GRCm39)	missense	probably benign	0.01
R8383:Rasal1	UTSW	5	120,804,420 (GRCm39)	missense	probably benign	0.01
R8710:Rasal1	UTSW	5	120,801,002 (GRCm39)	missense	probably benign	0.11
R8817:Rasal1	UTSW	5	120,808,416 (GRCm39)	missense	probably damaging	0.96
R9258:Rasal1	UTSW	5	120,793,155 (GRCm39)	missense	possibly damaging	0.91
R9300:Rasal1	UTSW	5	120,802,172 (GRCm39)	missense	probably damaging	1.00
R9394:Rasal1	UTSW	5	120,816,746 (GRCm39)	missense	probably benign
R9746:Rasal1	UTSW	5	120,800,358 (GRCm39)	missense	probably damaging	1.00
X0057:Rasal1	UTSW	5	120,802,577 (GRCm39)	critical splice donor site	probably null
Z1176:Rasal1	UTSW	5	120,802,914 (GRCm39)	missense	probably benign	0.00
Z1176:Rasal1	UTSW	5	120,790,881 (GRCm39)	missense	probably damaging	1.00
Z1177:Rasal1	UTSW	5	120,814,903 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCTAGGATAAGCCTTCTGACCCAAC -3'
(R):5'- CAGCAAGTCCATGACATGGGAACAA -3'

Sequencing Primer
(F):5'- GCCTTCTGACCCAACTTCCTC -3'
(R):5'- aaacacacactcatacatactcac -3'

Posted On

2014-04-24