Incidental Mutation 'R1227:Zfp108'
ID172408
Institutional Source Beutler Lab
Gene Symbol Zfp108
Ensembl Gene ENSMUSG00000030486
Gene Namezinc finger protein 108
Synonyms
MMRRC Submission 039296-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R1227 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location24254794-24262445 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24260460 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 159 (W159R)
Ref Sequence ENSEMBL: ENSMUSP00000072496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072713] [ENSMUST00000205982] [ENSMUST00000206777]
Predicted Effect probably benign
Transcript: ENSMUST00000072713
AA Change: W159R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000072496
Gene: ENSMUSG00000030486
AA Change: W159R

DomainStartEndE-ValueType
KRAB 8 63 7.94e-18 SMART
low complexity region 140 153 N/A INTRINSIC
ZnF_C2H2 281 303 1.33e-1 SMART
ZnF_C2H2 309 331 1.69e-3 SMART
ZnF_C2H2 337 359 1.3e-4 SMART
ZnF_C2H2 365 387 2.71e-2 SMART
ZnF_C2H2 393 415 5.14e-3 SMART
ZnF_C2H2 421 443 1.87e-5 SMART
ZnF_C2H2 449 471 3.44e-4 SMART
ZnF_C2H2 477 497 1.08e1 SMART
ZnF_C2H2 503 525 3.89e-3 SMART
ZnF_C2H2 531 553 2.09e-3 SMART
ZnF_C2H2 559 581 4.61e-5 SMART
ZnF_C2H2 587 609 7.9e-4 SMART
ZnF_C2H2 615 637 1.67e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205982
AA Change: W159R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000206777
AA Change: W159R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd42 T A 7: 92,605,300 H367L possibly damaging Het
Arvcf C T 16: 18,389,304 R43C probably benign Het
Camk1g T C 1: 193,347,433 E453G possibly damaging Het
Cmya5 A T 13: 93,094,446 L1378Q probably damaging Het
Cplx1 T C 5: 108,525,396 D53G possibly damaging Het
Ddx31 A G 2: 28,857,175 E222G probably damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Fermt2 A G 14: 45,459,990 S635P probably benign Het
Gls2 T C 10: 128,199,664 S104P probably damaging Het
Gm13023 A G 4: 143,793,564 H126R probably benign Het
Hnrnpul2 T G 19: 8,823,237 S226A possibly damaging Het
Klk5 T C 7: 43,847,246 probably null Het
Nuak1 T A 10: 84,440,309 T17S probably benign Het
Olfr1453 T C 19: 13,027,853 M159V probably benign Het
Olfr474 C A 7: 107,955,052 S137Y probably damaging Het
Prag1 G A 8: 36,139,951 E949K probably damaging Het
Rasal1 T C 5: 120,670,307 L468P probably damaging Het
Sez6l C A 5: 112,473,464 C248F probably damaging Het
Sstr2 T C 11: 113,624,885 I210T probably damaging Het
Tbc1d2 C T 4: 46,620,629 G394S probably benign Het
Other mutations in Zfp108
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00591:Zfp108 APN 7 24261486 missense possibly damaging 0.82
IGL01392:Zfp108 APN 7 24258447 splice site probably benign
R0123:Zfp108 UTSW 7 24260467 missense probably benign 0.00
R0126:Zfp108 UTSW 7 24260724 missense probably benign 0.01
R0134:Zfp108 UTSW 7 24260467 missense probably benign 0.00
R0243:Zfp108 UTSW 7 24261783 missense possibly damaging 0.81
R1464:Zfp108 UTSW 7 24260548 missense probably benign 0.00
R1464:Zfp108 UTSW 7 24260548 missense probably benign 0.00
R1731:Zfp108 UTSW 7 24258539 missense possibly damaging 0.75
R1739:Zfp108 UTSW 7 24261310 missense probably damaging 1.00
R1751:Zfp108 UTSW 7 24261896 missense probably damaging 1.00
R3713:Zfp108 UTSW 7 24261845 nonsense probably null
R3839:Zfp108 UTSW 7 24260556 missense probably benign 0.01
R3919:Zfp108 UTSW 7 24260832 missense probably damaging 0.99
R3922:Zfp108 UTSW 7 24261348 missense probably damaging 1.00
R4707:Zfp108 UTSW 7 24260412 missense probably benign 0.08
R4912:Zfp108 UTSW 7 24261314 missense probably damaging 1.00
R4965:Zfp108 UTSW 7 24260148 missense probably benign
R4989:Zfp108 UTSW 7 24260738 missense probably benign 0.00
R5014:Zfp108 UTSW 7 24260738 missense probably benign 0.00
R5163:Zfp108 UTSW 7 24260738 missense probably benign 0.00
R5183:Zfp108 UTSW 7 24260738 missense probably benign 0.00
R5184:Zfp108 UTSW 7 24260738 missense probably benign 0.00
R5185:Zfp108 UTSW 7 24260738 missense probably benign 0.00
R5453:Zfp108 UTSW 7 24261264 missense probably damaging 1.00
R5600:Zfp108 UTSW 7 24260586 missense probably benign 0.00
R6494:Zfp108 UTSW 7 24261357 missense probably damaging 1.00
R6601:Zfp108 UTSW 7 24261394 missense probably damaging 0.98
R6735:Zfp108 UTSW 7 24261772 missense probably damaging 1.00
R7646:Zfp108 UTSW 7 24261415 missense probably damaging 1.00
R7732:Zfp108 UTSW 7 24261527 missense probably benign 0.00
RF019:Zfp108 UTSW 7 24261607 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GAGAACTTAGCCCTTCAATGTCCCC -3'
(R):5'- TGATGACTTGATCACAGTCACCGC -3'

Sequencing Primer
(F):5'- TATATTCCCTTCAGGAGGCCAGAG -3'
(R):5'- ACAGTCACCGCTGCTGG -3'
Posted On2014-04-24