Incidental Mutation 'R1227:Gls2'
ID 172416
Institutional Source Beutler Lab
Gene Symbol Gls2
Ensembl Gene ENSMUSG00000044005
Gene Name glutaminase 2 (liver, mitochondrial)
Synonyms Lga, A330074B06Rik
MMRRC Submission 039296-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1227 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 128030504-128045873 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 128035533 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 104 (S104P)
Ref Sequence ENSEMBL: ENSMUSP00000119763 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044776] [ENSMUST00000123291] [ENSMUST00000143827] [ENSMUST00000159440]
AlphaFold Q571F8
Predicted Effect probably damaging
Transcript: ENSMUST00000044776
AA Change: S104P

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000047376
Gene: ENSMUSG00000044005
AA Change: S104P

DomainStartEndE-ValueType
Pfam:Glutaminase 177 463 1.1e-116 PFAM
ANK 518 548 3.76e-5 SMART
ANK 552 581 1.21e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123291
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123385
Predicted Effect unknown
Transcript: ENSMUST00000134104
AA Change: S96P
SMART Domains Protein: ENSMUSP00000123436
Gene: ENSMUSG00000044005
AA Change: S96P

DomainStartEndE-ValueType
PDB:4JKT|D 60 172 1e-48 PDB
low complexity region 191 201 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134461
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135441
Predicted Effect probably damaging
Transcript: ENSMUST00000143827
AA Change: S104P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119763
Gene: ENSMUSG00000044005
AA Change: S104P

DomainStartEndE-ValueType
PDB:4JKT|D 67 135 5e-25 PDB
low complexity region 170 186 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152928
Predicted Effect probably damaging
Transcript: ENSMUST00000159440
AA Change: S104P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124239
Gene: ENSMUSG00000044005
AA Change: S104P

DomainStartEndE-ValueType
PDB:4JKT|D 67 134 9e-25 PDB
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a mitochondrial phosphate-activated glutaminase that catalyzes the hydrolysis of glutamine to stoichiometric amounts of glutamate and ammonia. Originally thought to be liver-specific, this protein has been found in other tissues as well. Alternative splicing results in multiple transcript variants that encode different isoforms. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd42 T A 7: 92,254,508 (GRCm39) H367L possibly damaging Het
Arvcf C T 16: 18,207,169 (GRCm39) R43C probably benign Het
Camk1g T C 1: 193,029,741 (GRCm39) E453G possibly damaging Het
Cmya5 A T 13: 93,230,954 (GRCm39) L1378Q probably damaging Het
Cplx1 T C 5: 108,673,262 (GRCm39) D53G possibly damaging Het
Ddx31 A G 2: 28,747,187 (GRCm39) E222G probably damaging Het
Dync1h1 G A 12: 110,602,943 (GRCm39) E2195K probably benign Het
Fermt2 A G 14: 45,697,447 (GRCm39) S635P probably benign Het
Hnrnpul2 T G 19: 8,800,601 (GRCm39) S226A possibly damaging Het
Klk1b5 T C 7: 43,496,670 (GRCm39) probably null Het
Nuak1 T A 10: 84,276,173 (GRCm39) T17S probably benign Het
Or5b101 T C 19: 13,005,217 (GRCm39) M159V probably benign Het
Or5p54 C A 7: 107,554,259 (GRCm39) S137Y probably damaging Het
Prag1 G A 8: 36,607,105 (GRCm39) E949K probably damaging Het
Pramel25 A G 4: 143,520,134 (GRCm39) H126R probably benign Het
Rasal1 T C 5: 120,808,372 (GRCm39) L468P probably damaging Het
Sez6l C A 5: 112,621,330 (GRCm39) C248F probably damaging Het
Sstr2 T C 11: 113,515,711 (GRCm39) I210T probably damaging Het
Tbc1d2 C T 4: 46,620,629 (GRCm39) G394S probably benign Het
Zfp108 T A 7: 23,959,885 (GRCm39) W159R probably benign Het
Other mutations in Gls2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Gls2 APN 10 128,036,840 (GRCm39) splice site probably null
IGL00583:Gls2 APN 10 128,040,751 (GRCm39) missense probably benign 0.11
IGL01444:Gls2 APN 10 128,037,216 (GRCm39) missense probably damaging 1.00
IGL02746:Gls2 APN 10 128,036,825 (GRCm39) missense probably damaging 1.00
R0015:Gls2 UTSW 10 128,045,219 (GRCm39) missense probably damaging 1.00
R0024:Gls2 UTSW 10 128,035,125 (GRCm39) missense probably damaging 1.00
R0378:Gls2 UTSW 10 128,043,180 (GRCm39) missense probably benign
R1179:Gls2 UTSW 10 128,035,103 (GRCm39) missense probably damaging 1.00
R1421:Gls2 UTSW 10 128,037,217 (GRCm39) nonsense probably null
R1750:Gls2 UTSW 10 128,037,194 (GRCm39) missense probably damaging 1.00
R1952:Gls2 UTSW 10 128,045,231 (GRCm39) missense probably benign
R2218:Gls2 UTSW 10 128,040,583 (GRCm39) missense probably damaging 1.00
R2291:Gls2 UTSW 10 128,043,479 (GRCm39) nonsense probably null
R2382:Gls2 UTSW 10 128,039,711 (GRCm39) missense probably damaging 1.00
R4536:Gls2 UTSW 10 128,036,806 (GRCm39) missense probably benign 0.00
R5305:Gls2 UTSW 10 128,040,578 (GRCm39) nonsense probably null
R5435:Gls2 UTSW 10 128,030,995 (GRCm39) intron probably benign
R5767:Gls2 UTSW 10 128,041,090 (GRCm39) missense probably damaging 1.00
R7223:Gls2 UTSW 10 128,035,063 (GRCm39) missense probably benign
R7767:Gls2 UTSW 10 128,030,998 (GRCm39) missense unknown
R8068:Gls2 UTSW 10 128,030,983 (GRCm39) missense unknown
R8084:Gls2 UTSW 10 128,035,125 (GRCm39) missense probably damaging 1.00
R8329:Gls2 UTSW 10 128,037,154 (GRCm39) missense probably benign 0.00
R8872:Gls2 UTSW 10 128,040,535 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCGTATCCCTATCCACAAGTTCACC -3'
(R):5'- ACCACAGCTATGGGCTTTAGCATTG -3'

Sequencing Primer
(F):5'- AGAACACCTTTCGTGAGCTG -3'
(R):5'- GGCTTTAGCATTGAGAAGTCC -3'
Posted On 2014-04-24