Incidental Mutation 'R1227:Sstr2'
ID 172417
Institutional Source Beutler Lab
Gene Symbol Sstr2
Ensembl Gene ENSMUSG00000047904
Gene Name somatostatin receptor 2
Synonyms SSTR-2, Smstr2, Smstr-2, sst2
MMRRC Submission 039296-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.759) question?
Stock # R1227 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 113619342-113626028 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 113624885 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 210 (I210T)
Ref Sequence ENSEMBL: ENSMUSP00000138101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067591] [ENSMUST00000106630] [ENSMUST00000125890] [ENSMUST00000136392] [ENSMUST00000146031] [ENSMUST00000146390]
AlphaFold P30875
Predicted Effect probably damaging
Transcript: ENSMUST00000067591
AA Change: I210T

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000068578
Gene: ENSMUSG00000047904
AA Change: I210T

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 51 281 1.1e-10 PFAM
Pfam:7TM_GPCR_Srsx 54 327 1.9e-20 PFAM
Pfam:7tm_1 60 312 2.5e-70 PFAM
Pfam:7TM_GPCR_Srv 118 329 4.9e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106630
AA Change: I210T

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102241
Gene: ENSMUSG00000047904
AA Change: I210T

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 51 284 1.3e-10 PFAM
Pfam:7TM_GPCR_Srsx 54 327 1.9e-20 PFAM
Pfam:7tm_1 60 312 1.4e-65 PFAM
Pfam:7TM_GPCR_Srv 119 328 4.3e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123153
Predicted Effect probably benign
Transcript: ENSMUST00000125890
SMART Domains Protein: ENSMUSP00000115472
Gene: ENSMUSG00000041654

DomainStartEndE-ValueType
Pfam:Zip 7 200 3.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136392
Predicted Effect probably benign
Transcript: ENSMUST00000146031
SMART Domains Protein: ENSMUSP00000121286
Gene: ENSMUSG00000041654

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
transmembrane domain 39 61 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000146390
AA Change: I210T

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138101
Gene: ENSMUSG00000047904
AA Change: I210T

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 51 284 1.8e-10 PFAM
Pfam:7TM_GPCR_Srsx 54 327 2.4e-20 PFAM
Pfam:7tm_1 60 312 3.1e-70 PFAM
Pfam:7TM_GPCR_Srv 118 329 5.7e-13 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.9%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a receptor for somatostatin, which acts at many sites to inhibit the release of several hormones and other secretory proteins. The encoded protein is a member of the superfamily of receptors having seven transmembrane segments and is involved in many processes, including adenylyl cyclase inhibition, phosphotyrosine phosphatase stimulation, and inhibition of calcium entry and cell growth. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for a null allele show elevated anxiety and locomotor and exploratory deficits. Homozygotes for a reporter allele show altered motor coordination, somatostatin-induced dopamine and glutamate release, retinal rod bipolar cells and EEG patterns, and reduced infarction after focal ischemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd42 T A 7: 92,605,300 H367L possibly damaging Het
Arvcf C T 16: 18,389,304 R43C probably benign Het
Camk1g T C 1: 193,347,433 E453G possibly damaging Het
Cmya5 A T 13: 93,094,446 L1378Q probably damaging Het
Cplx1 T C 5: 108,525,396 D53G possibly damaging Het
Ddx31 A G 2: 28,857,175 E222G probably damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Fermt2 A G 14: 45,459,990 S635P probably benign Het
Gls2 T C 10: 128,199,664 S104P probably damaging Het
Gm13023 A G 4: 143,793,564 H126R probably benign Het
Hnrnpul2 T G 19: 8,823,237 S226A possibly damaging Het
Klk5 T C 7: 43,847,246 probably null Het
Nuak1 T A 10: 84,440,309 T17S probably benign Het
Olfr1453 T C 19: 13,027,853 M159V probably benign Het
Olfr474 C A 7: 107,955,052 S137Y probably damaging Het
Prag1 G A 8: 36,139,951 E949K probably damaging Het
Rasal1 T C 5: 120,670,307 L468P probably damaging Het
Sez6l C A 5: 112,473,464 C248F probably damaging Het
Tbc1d2 C T 4: 46,620,629 G394S probably benign Het
Zfp108 T A 7: 24,260,460 W159R probably benign Het
Other mutations in Sstr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Sstr2 APN 11 113624995 missense probably benign 0.22
IGL01555:Sstr2 APN 11 113625619 missense probably benign 0.32
IGL02173:Sstr2 APN 11 113625016 missense probably damaging 1.00
IGL02430:Sstr2 APN 11 113624804 missense probably damaging 0.99
chat UTSW 11 113624549 missense probably damaging 1.00
R0125:Sstr2 UTSW 11 113624477 missense probably damaging 1.00
R0565:Sstr2 UTSW 11 113625619 missense probably benign 0.32
R1356:Sstr2 UTSW 11 113624894 missense probably damaging 1.00
R1992:Sstr2 UTSW 11 113624669 missense probably benign 0.03
R2504:Sstr2 UTSW 11 113624431 missense probably damaging 0.98
R2509:Sstr2 UTSW 11 113624923 missense probably damaging 0.99
R2510:Sstr2 UTSW 11 113624923 missense probably damaging 0.99
R2511:Sstr2 UTSW 11 113624923 missense probably damaging 0.99
R4051:Sstr2 UTSW 11 113624656 missense probably damaging 1.00
R4083:Sstr2 UTSW 11 113625245 missense probably benign 0.05
R4207:Sstr2 UTSW 11 113624656 missense probably damaging 1.00
R4208:Sstr2 UTSW 11 113624656 missense probably damaging 1.00
R5666:Sstr2 UTSW 11 113624713 missense probably damaging 1.00
R6264:Sstr2 UTSW 11 113625106 missense probably damaging 1.00
R6339:Sstr2 UTSW 11 113624549 missense probably damaging 1.00
R6443:Sstr2 UTSW 11 113625254 splice site probably null
R6968:Sstr2 UTSW 11 113624948 missense probably damaging 1.00
R7146:Sstr2 UTSW 11 113625353 missense probably damaging 1.00
R7735:Sstr2 UTSW 11 113624597 missense possibly damaging 0.75
R8057:Sstr2 UTSW 11 113624273 missense probably benign
R8086:Sstr2 UTSW 11 113625172 missense probably damaging 1.00
R8087:Sstr2 UTSW 11 113624675 missense probably damaging 1.00
R9076:Sstr2 UTSW 11 113624351 missense probably benign 0.00
R9194:Sstr2 UTSW 11 113624377 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CTCCGCTATGCCAAGATGAAGACC -3'
(R):5'- GATGAAGACAGCCACTACGATGGAC -3'

Sequencing Primer
(F):5'- GCAGATGAACTCTTCATGCTAGG -3'
(R):5'- TACGATGGACACCATGCG -3'
Posted On 2014-04-24