Incidental Mutation 'R1227:Fermt2'
ID172420
Institutional Source Beutler Lab
Gene Symbol Fermt2
Ensembl Gene ENSMUSG00000037712
Gene Namefermitin family member 2
SynonymsPlekhc1, Mig2, Kindlin-2
MMRRC Submission 039296-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1227 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location45458795-45530118 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45459990 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 635 (S635P)
Ref Sequence ENSEMBL: ENSMUSP00000044554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045905]
Predicted Effect probably benign
Transcript: ENSMUST00000045905
AA Change: S635P

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000044554
Gene: ENSMUSG00000037712
AA Change: S635P

DomainStartEndE-ValueType
Blast:B41 16 45 2e-9 BLAST
low complexity region 46 57 N/A INTRINSIC
B41 93 573 5.09e-56 SMART
PH 373 478 2.7e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158144
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mice are embryonic lethal at or before E7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd42 T A 7: 92,605,300 H367L possibly damaging Het
Arvcf C T 16: 18,389,304 R43C probably benign Het
Camk1g T C 1: 193,347,433 E453G possibly damaging Het
Cmya5 A T 13: 93,094,446 L1378Q probably damaging Het
Cplx1 T C 5: 108,525,396 D53G possibly damaging Het
Ddx31 A G 2: 28,857,175 E222G probably damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Gls2 T C 10: 128,199,664 S104P probably damaging Het
Gm13023 A G 4: 143,793,564 H126R probably benign Het
Hnrnpul2 T G 19: 8,823,237 S226A possibly damaging Het
Klk5 T C 7: 43,847,246 probably null Het
Nuak1 T A 10: 84,440,309 T17S probably benign Het
Olfr1453 T C 19: 13,027,853 M159V probably benign Het
Olfr474 C A 7: 107,955,052 S137Y probably damaging Het
Prag1 G A 8: 36,139,951 E949K probably damaging Het
Rasal1 T C 5: 120,670,307 L468P probably damaging Het
Sez6l C A 5: 112,473,464 C248F probably damaging Het
Sstr2 T C 11: 113,624,885 I210T probably damaging Het
Tbc1d2 C T 4: 46,620,629 G394S probably benign Het
Zfp108 T A 7: 24,260,460 W159R probably benign Het
Other mutations in Fermt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01301:Fermt2 APN 14 45464863 missense probably damaging 1.00
IGL01859:Fermt2 APN 14 45459956 missense possibly damaging 0.94
IGL02719:Fermt2 APN 14 45504656 missense probably damaging 1.00
IGL03182:Fermt2 APN 14 45461768 missense possibly damaging 0.77
ANU18:Fermt2 UTSW 14 45464863 missense probably damaging 1.00
R0107:Fermt2 UTSW 14 45464822 missense probably damaging 0.98
R0671:Fermt2 UTSW 14 45469319 missense probably benign 0.09
R1172:Fermt2 UTSW 14 45459968 missense possibly damaging 0.91
R1480:Fermt2 UTSW 14 45461787 missense possibly damaging 0.88
R2219:Fermt2 UTSW 14 45475897 missense probably benign
R2937:Fermt2 UTSW 14 45504491 splice site probably null
R4765:Fermt2 UTSW 14 45462236 missense probably benign 0.01
R5921:Fermt2 UTSW 14 45464746 missense probably damaging 1.00
R6063:Fermt2 UTSW 14 45459881 missense possibly damaging 0.77
R6216:Fermt2 UTSW 14 45459881 missense possibly damaging 0.77
R6254:Fermt2 UTSW 14 45476059 missense probably damaging 1.00
R6964:Fermt2 UTSW 14 45465142 missense probably damaging 0.99
R7574:Fermt2 UTSW 14 45469325 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATACGGCATATCAAGGTAGGCAGC -3'
(R):5'- CACTCGGGACCTTAACGACGTAAAC -3'

Sequencing Primer
(F):5'- CAGCAGATTAACAATCGTGCTTG -3'
(R):5'- CGTAAACGCCTTGAGAACTTG -3'
Posted On2014-04-24