Incidental Mutation 'R1323:Paqr5'
ID172459
Institutional Source Beutler Lab
Gene Symbol Paqr5
Ensembl Gene ENSMUSG00000032278
Gene Nameprogestin and adipoQ receptor family member V
Synonyms0610010I15Rik, mPRg
MMRRC Submission 039389-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R1323 (G1)
Quality Score223
Status Not validated
Chromosome9
Chromosomal Location61953481-62026856 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 61961528 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034817] [ENSMUST00000113990] [ENSMUST00000113990]
Predicted Effect probably null
Transcript: ENSMUST00000034817
SMART Domains Protein: ENSMUSP00000034817
Gene: ENSMUSG00000032278

DomainStartEndE-ValueType
Pfam:HlyIII 43 269 1.6e-59 PFAM
transmembrane domain 295 317 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113990
SMART Domains Protein: ENSMUSP00000109623
Gene: ENSMUSG00000032278

DomainStartEndE-ValueType
Pfam:HlyIII 29 255 6.4e-51 PFAM
transmembrane domain 281 303 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113990
SMART Domains Protein: ENSMUSP00000109623
Gene: ENSMUSG00000032278

DomainStartEndE-ValueType
Pfam:HlyIII 29 255 6.4e-51 PFAM
transmembrane domain 281 303 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135050
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C A 11: 9,290,937 F933L possibly damaging Het
Abcc8 T G 7: 46,117,362 Q998P probably benign Het
Akr1e1 C T 13: 4,607,548 G17E probably damaging Het
Ankrd44 A G 1: 54,766,450 probably benign Het
BC055324 C A 1: 163,955,461 probably benign Het
D630045J12Rik T C 6: 38,148,508 I1524V probably damaging Het
Elovl1 T C 4: 118,431,654 L103P possibly damaging Het
Emsy T C 7: 98,610,657 probably benign Het
Fam171a2 T G 11: 102,444,125 D62A probably damaging Het
Frzb G A 2: 80,413,376 P320S probably benign Het
Fsip2 G T 2: 82,985,752 G3943V probably damaging Het
Gm813 G A 16: 58,616,915 P10L possibly damaging Het
Grm8 A G 6: 28,125,974 L51P probably damaging Het
Hist1h2al T G 13: 51,203,064 noncoding transcript Het
Hnf4g T C 3: 3,634,221 S4P possibly damaging Het
Megf8 T A 7: 25,360,102 probably null Het
Mtnr1b A G 9: 15,863,136 F209S probably damaging Het
Nckipsd G A 9: 108,812,579 R313Q probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
S100a14 T C 3: 90,527,736 V18A probably damaging Het
Sycp2 A T 2: 178,347,621 S1441R possibly damaging Het
Vmn2r101 G A 17: 19,612,051 D770N probably damaging Het
Zfp600 A G 4: 146,196,691 Y643C probably damaging Het
Other mutations in Paqr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02893:Paqr5 APN 9 61968868 missense probably benign 0.00
IGL03190:Paqr5 APN 9 61972802 missense probably damaging 0.97
PIT4480001:Paqr5 UTSW 9 61956156 missense probably benign 0.09
R0528:Paqr5 UTSW 9 61956245 missense probably damaging 1.00
R0686:Paqr5 UTSW 9 61972794 missense probably benign 0.00
R0688:Paqr5 UTSW 9 61972794 missense probably benign 0.00
R1323:Paqr5 UTSW 9 61961528 critical splice donor site probably null
R2872:Paqr5 UTSW 9 61968779 critical splice donor site probably null
R2872:Paqr5 UTSW 9 61968779 critical splice donor site probably null
R5663:Paqr5 UTSW 9 61968862 missense probably benign 0.03
R6726:Paqr5 UTSW 9 61963783 missense probably damaging 1.00
R6728:Paqr5 UTSW 9 61963783 missense probably damaging 1.00
R6795:Paqr5 UTSW 9 61963783 missense probably damaging 1.00
R6796:Paqr5 UTSW 9 61963783 missense probably damaging 1.00
R6809:Paqr5 UTSW 9 61968782 missense probably null 1.00
R6857:Paqr5 UTSW 9 61976088 missense probably damaging 1.00
R6967:Paqr5 UTSW 9 61972831 nonsense probably null
R7456:Paqr5 UTSW 9 61972790 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- CATTGGAATGCCTACCTGTGTCCC -3'
(R):5'- GATAGGACTGCTCTACAATGCCTGC -3'

Sequencing Primer
(F):5'- TCCCTGGCAGTGTAGTAGC -3'
(R):5'- ccctcccttcctccctc -3'
Posted On2014-04-24