Incidental Mutation 'R1626:Ptprz1'
ID172494
Institutional Source Beutler Lab
Gene Symbol Ptprz1
Ensembl Gene ENSMUSG00000068748
Gene Nameprotein tyrosine phosphatase, receptor type Z, polypeptide 1
SynonymsPTPzeta, RPTPz, phosphacan, Rptpbeta, DSD-1-PG, PTPbeta, Ptprz, Ptpz
MMRRC Submission 039663-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.644) question?
Stock #R1626 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location22875502-23052916 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23001574 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 1221 (Q1221L)
Ref Sequence ENSEMBL: ENSMUSP00000144605 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090568] [ENSMUST00000202102] [ENSMUST00000202579]
Predicted Effect probably benign
Transcript: ENSMUST00000090568
AA Change: Q1221L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000088056
Gene: ENSMUSG00000068748
AA Change: Q1221L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Carb_anhydrase 38 300 5.12e-99 SMART
FN3 312 397 5.53e-4 SMART
low complexity region 588 609 N/A INTRINSIC
low complexity region 825 837 N/A INTRINSIC
low complexity region 1417 1441 N/A INTRINSIC
low complexity region 1485 1495 N/A INTRINSIC
Blast:PTPc 1497 1573 1e-12 BLAST
low complexity region 1606 1620 N/A INTRINSIC
transmembrane domain 1637 1659 N/A INTRINSIC
low complexity region 1679 1693 N/A INTRINSIC
PTPc 1720 1991 2.8e-130 SMART
PTPc 2019 2281 1.65e-77 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201827
Predicted Effect probably benign
Transcript: ENSMUST00000202102
SMART Domains Protein: ENSMUSP00000143902
Gene: ENSMUSG00000068748

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Carb_anhydrase 38 300 5.12e-99 SMART
FN3 312 397 5.53e-4 SMART
low complexity region 588 609 N/A INTRINSIC
transmembrane domain 788 810 N/A INTRINSIC
low complexity region 830 844 N/A INTRINSIC
PTPc 871 1142 2.8e-130 SMART
PTPc 1170 1432 1.65e-77 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202579
AA Change: Q1221L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144605
Gene: ENSMUSG00000068748
AA Change: Q1221L

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Carb_anhydrase 38 300 4e-103 SMART
FN3 312 397 2.8e-6 SMART
low complexity region 588 609 N/A INTRINSIC
low complexity region 825 837 N/A INTRINSIC
low complexity region 1417 1441 N/A INTRINSIC
low complexity region 1485 1495 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the receptor protein tyrosine phosphatase family. Expression of this gene is restricted to the central nervous system (CNS), and it may be involved in the regulation of specific developmental processes in the CNS. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for targeted null mutations demonstrate an impaired ability to recover from inflamatory lesions of the CNS or gastric mucosa. Mice homozygous for a knock-out allele exhibit increased tactile and thermal nociception thresholds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik T C 10: 21,621,672 Y71H possibly damaging Het
Acsl6 C A 11: 54,352,046 P628T probably damaging Het
Ak7 A G 12: 105,768,548 D591G probably benign Het
Anxa5 T C 3: 36,461,981 D66G probably damaging Het
Cacna1b G A 2: 24,606,709 T2283I probably damaging Het
Cand1 A T 10: 119,210,014 D995E possibly damaging Het
Cblc G T 7: 19,796,502 A94E probably damaging Het
Cd48 G A 1: 171,682,119 C9Y probably benign Het
Chd9 A G 8: 90,994,596 K1004R probably benign Het
Cldn1 T C 16: 26,371,452 T59A probably damaging Het
Col11a1 G A 3: 114,131,569 G17D probably damaging Het
Cpeb1 A G 7: 81,436,247 V49A probably damaging Het
Cyp4b1 G T 4: 115,641,658 P109Q probably damaging Het
Dhrs7b T A 11: 60,844,256 F23I possibly damaging Het
Dnah9 C A 11: 66,085,267 A1319S probably benign Het
Egf A T 3: 129,686,215 V553D possibly damaging Het
Fbn1 T C 2: 125,341,279 D1760G probably damaging Het
Fbxo31 A G 8: 121,560,006 F178L probably damaging Het
Fstl4 C A 11: 53,000,290 S85* probably null Het
Gfm1 A G 3: 67,438,644 Y225C probably damaging Het
Gm10797 A T 10: 67,572,623 noncoding transcript Het
Heatr4 T A 12: 83,973,721 I499L probably benign Het
Hist1h3g G A 13: 23,535,551 V36M probably damaging Het
Ick A G 9: 78,150,637 Y156C probably damaging Het
Igfn1 A T 1: 135,968,967 M1287K probably benign Het
Inpp5b C A 4: 124,783,903 D385E probably damaging Het
Lrrc9 A G 12: 72,495,661 probably null Het
Ltb4r1 A G 14: 55,767,242 M1V probably null Het
Macf1 T C 4: 123,471,534 I3145V probably benign Het
Man2a2 T C 7: 80,367,702 N277S probably damaging Het
Megf6 G T 4: 154,177,121 V68L probably benign Het
Mgat4e A G 1: 134,541,278 Y343H probably benign Het
Noxred1 T C 12: 87,221,255 *367W probably null Het
Nupl1 A T 14: 60,242,627 L190* probably null Het
Olfml2a G T 2: 38,951,263 K270N probably damaging Het
Olfr368 A G 2: 37,332,762 probably null Het
Olfr850 A G 9: 19,478,199 L14P probably damaging Het
Phgdh G T 3: 98,316,409 Q359K probably benign Het
Plpp5 G T 8: 25,722,577 C200F possibly damaging Het
Pole A C 5: 110,293,369 I230L probably benign Het
Prtg A T 9: 72,844,911 D193V probably damaging Het
Ptgs2 G A 1: 150,103,868 probably null Het
Rufy2 T C 10: 62,995,372 I204T probably benign Het
Rybp A G 6: 100,232,958 S115P possibly damaging Het
Samd13 A G 3: 146,662,726 V37A probably benign Het
Secisbp2l T G 2: 125,775,686 K24Q probably damaging Het
Sorbs2 A G 8: 45,769,854 Y198C probably damaging Het
Svil T G 18: 5,117,099 probably null Het
Ttc24 G T 3: 88,070,059 R127S probably benign Het
Ttn C T 2: 76,758,544 V21394M probably damaging Het
Tubal3 G T 13: 3,932,841 C207F probably damaging Het
Vmn2r16 A T 5: 109,363,577 D550V probably damaging Het
Vmn2r2 T A 3: 64,134,500 I265F possibly damaging Het
Zfp507 T C 7: 35,795,433 K62E probably damaging Het
Other mutations in Ptprz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Ptprz1 APN 6 22973054 missense probably damaging 1.00
IGL00773:Ptprz1 APN 6 23002629 missense probably benign 0.41
IGL01458:Ptprz1 APN 6 22972844 missense probably damaging 0.99
IGL01481:Ptprz1 APN 6 22999980 missense probably benign 0.05
IGL01501:Ptprz1 APN 6 22973082 missense probably damaging 1.00
IGL01601:Ptprz1 APN 6 23000438 missense probably damaging 0.99
IGL01882:Ptprz1 APN 6 23000464 missense probably damaging 1.00
IGL02058:Ptprz1 APN 6 23002503 missense probably benign 0.00
IGL02089:Ptprz1 APN 6 23033448 missense probably damaging 1.00
IGL02136:Ptprz1 APN 6 22972822 missense probably damaging 1.00
IGL02215:Ptprz1 APN 6 22965182 missense possibly damaging 0.91
IGL02220:Ptprz1 APN 6 23042743 splice site probably benign
IGL02556:Ptprz1 APN 6 22972845 missense probably benign 0.01
IGL02601:Ptprz1 APN 6 23000687 missense probably benign 0.11
IGL02620:Ptprz1 APN 6 22959740 missense probably damaging 1.00
IGL02666:Ptprz1 APN 6 23001210 missense probably benign 0.00
IGL02718:Ptprz1 APN 6 23001349 missense possibly damaging 0.77
IGL02792:Ptprz1 APN 6 22959723 missense probably damaging 1.00
IGL02894:Ptprz1 APN 6 23035149 missense probably damaging 1.00
IGL02952:Ptprz1 APN 6 23036926 missense probably damaging 1.00
IGL03003:Ptprz1 APN 6 23002583 missense probably damaging 0.98
IGL03060:Ptprz1 APN 6 22972835 missense probably damaging 1.00
IGL03170:Ptprz1 APN 6 22959767 missense probably benign 0.00
IGL03246:Ptprz1 APN 6 22986160 missense probably damaging 0.99
IGL03349:Ptprz1 APN 6 23000332 missense probably damaging 1.00
IGL03365:Ptprz1 APN 6 23030582 splice site probably benign
R0044:Ptprz1 UTSW 6 23007403 missense probably damaging 1.00
R0054:Ptprz1 UTSW 6 22986196 missense probably damaging 1.00
R0054:Ptprz1 UTSW 6 22986196 missense probably damaging 1.00
R0107:Ptprz1 UTSW 6 23000570 missense probably damaging 0.98
R0278:Ptprz1 UTSW 6 23000817 missense probably benign 0.31
R0345:Ptprz1 UTSW 6 23016165 missense probably damaging 1.00
R0359:Ptprz1 UTSW 6 22973176 splice site probably benign
R0743:Ptprz1 UTSW 6 23044367 nonsense probably null
R1014:Ptprz1 UTSW 6 23000644 missense probably damaging 1.00
R1016:Ptprz1 UTSW 6 23000974 missense probably damaging 1.00
R1106:Ptprz1 UTSW 6 22965749 missense probably damaging 0.99
R1391:Ptprz1 UTSW 6 23001729 missense probably benign 0.33
R1424:Ptprz1 UTSW 6 23000383 missense probably benign 0.00
R1445:Ptprz1 UTSW 6 23050474 missense probably damaging 1.00
R1496:Ptprz1 UTSW 6 23049524 splice site probably benign
R1544:Ptprz1 UTSW 6 23000748 missense possibly damaging 0.63
R1641:Ptprz1 UTSW 6 23049606 missense probably damaging 1.00
R1757:Ptprz1 UTSW 6 23044320 missense probably damaging 1.00
R1812:Ptprz1 UTSW 6 22959712 missense probably benign 0.07
R1917:Ptprz1 UTSW 6 23035040 splice site probably benign
R1930:Ptprz1 UTSW 6 23007355 missense probably damaging 1.00
R1931:Ptprz1 UTSW 6 23007355 missense probably damaging 1.00
R1974:Ptprz1 UTSW 6 22986311 missense probably damaging 1.00
R1992:Ptprz1 UTSW 6 22959748 missense probably benign 0.24
R1997:Ptprz1 UTSW 6 23050497 missense probably damaging 0.99
R2002:Ptprz1 UTSW 6 23027834 nonsense probably null
R2012:Ptprz1 UTSW 6 23001027 missense probably benign 0.03
R2059:Ptprz1 UTSW 6 22986323 splice site probably benign
R2061:Ptprz1 UTSW 6 23049675 critical splice donor site probably null
R2064:Ptprz1 UTSW 6 23050389 splice site probably benign
R2067:Ptprz1 UTSW 6 23050389 splice site probably benign
R2108:Ptprz1 UTSW 6 23033477 missense probably damaging 0.99
R2152:Ptprz1 UTSW 6 23030671 missense probably damaging 0.99
R2166:Ptprz1 UTSW 6 23045633 missense possibly damaging 0.90
R2183:Ptprz1 UTSW 6 23002285 missense probably benign
R2202:Ptprz1 UTSW 6 23000650 missense possibly damaging 0.63
R2238:Ptprz1 UTSW 6 22987377 missense probably damaging 1.00
R2290:Ptprz1 UTSW 6 23000991 missense probably damaging 1.00
R3027:Ptprz1 UTSW 6 23016197 missense possibly damaging 0.89
R3861:Ptprz1 UTSW 6 23036895 missense probably damaging 0.98
R4012:Ptprz1 UTSW 6 23002585 missense probably damaging 0.99
R4020:Ptprz1 UTSW 6 22959624 splice site probably benign
R4158:Ptprz1 UTSW 6 23001684 nonsense probably null
R4158:Ptprz1 UTSW 6 23022205 missense possibly damaging 0.73
R4159:Ptprz1 UTSW 6 23001684 nonsense probably null
R4160:Ptprz1 UTSW 6 23022205 missense possibly damaging 0.73
R4606:Ptprz1 UTSW 6 23001487 missense possibly damaging 0.80
R4621:Ptprz1 UTSW 6 23001454 missense possibly damaging 0.68
R4640:Ptprz1 UTSW 6 22972798 missense probably damaging 1.00
R4731:Ptprz1 UTSW 6 23002610 missense probably benign 0.06
R4732:Ptprz1 UTSW 6 23002610 missense probably benign 0.06
R4733:Ptprz1 UTSW 6 23002610 missense probably benign 0.06
R4803:Ptprz1 UTSW 6 23001546 missense probably benign 0.00
R4890:Ptprz1 UTSW 6 23024958 missense probably damaging 1.00
R5035:Ptprz1 UTSW 6 23016215 missense probably benign 0.06
R5052:Ptprz1 UTSW 6 23045626 missense probably damaging 1.00
R5106:Ptprz1 UTSW 6 23000028 missense probably benign 0.04
R5248:Ptprz1 UTSW 6 23001901 missense probably benign 0.11
R5292:Ptprz1 UTSW 6 23002582 missense probably benign 0.31
R5373:Ptprz1 UTSW 6 23007355 missense probably damaging 1.00
R5374:Ptprz1 UTSW 6 23007355 missense probably damaging 1.00
R5378:Ptprz1 UTSW 6 23007402 missense probably damaging 1.00
R5408:Ptprz1 UTSW 6 23002600 missense probably damaging 1.00
R5479:Ptprz1 UTSW 6 23001666 missense probably benign
R5524:Ptprz1 UTSW 6 22986318 splice site probably null
R5527:Ptprz1 UTSW 6 23000053 missense possibly damaging 0.66
R5557:Ptprz1 UTSW 6 23001001 missense probably benign 0.04
R5654:Ptprz1 UTSW 6 22986134 missense probably damaging 1.00
R5655:Ptprz1 UTSW 6 22999773 missense probably benign 0.00
R5658:Ptprz1 UTSW 6 23016189 missense probably damaging 1.00
R5663:Ptprz1 UTSW 6 23035143 missense probably damaging 1.00
R5765:Ptprz1 UTSW 6 23000236 missense probably damaging 1.00
R5822:Ptprz1 UTSW 6 23001445 missense probably benign 0.01
R5837:Ptprz1 UTSW 6 23001418 missense probably benign 0.00
R6108:Ptprz1 UTSW 6 23045659 missense probably damaging 1.00
R6199:Ptprz1 UTSW 6 23002471 missense probably benign 0.01
R6245:Ptprz1 UTSW 6 23051990 missense probably damaging 1.00
R6257:Ptprz1 UTSW 6 22959640 missense probably damaging 1.00
R6488:Ptprz1 UTSW 6 23001517 nonsense probably null
R6606:Ptprz1 UTSW 6 23002501 missense probably benign 0.27
R6612:Ptprz1 UTSW 6 23052082 missense probably damaging 1.00
R6824:Ptprz1 UTSW 6 23002131 missense probably benign 0.05
R6834:Ptprz1 UTSW 6 22999633 missense probably benign 0.38
R6836:Ptprz1 UTSW 6 23030665 nonsense probably null
R6991:Ptprz1 UTSW 6 23002687 missense probably benign 0.00
R7044:Ptprz1 UTSW 6 23044346 missense probably damaging 1.00
R7048:Ptprz1 UTSW 6 22961623 missense probably benign 0.18
R7225:Ptprz1 UTSW 6 23000929 missense possibly damaging 0.61
R7284:Ptprz1 UTSW 6 23000098 missense probably damaging 1.00
R7360:Ptprz1 UTSW 6 23000907 missense probably damaging 1.00
R7501:Ptprz1 UTSW 6 23001747 nonsense probably null
R7515:Ptprz1 UTSW 6 23022267 missense probably damaging 1.00
R7538:Ptprz1 UTSW 6 22999896 missense possibly damaging 0.81
R7567:Ptprz1 UTSW 6 22959780 missense probably damaging 0.97
R7599:Ptprz1 UTSW 6 23002519 missense not run
R7611:Ptprz1 UTSW 6 23001220 missense probably benign
R7685:Ptprz1 UTSW 6 23024978 missense probably damaging 1.00
R7707:Ptprz1 UTSW 6 23002296 missense probably benign 0.00
R7733:Ptprz1 UTSW 6 23000384 missense probably benign 0.31
R7786:Ptprz1 UTSW 6 23036993 missense probably damaging 1.00
R7868:Ptprz1 UTSW 6 23000964 missense not run
R7882:Ptprz1 UTSW 6 23002257 missense probably benign 0.13
R7968:Ptprz1 UTSW 6 22959676 missense probably damaging 0.98
R8024:Ptprz1 UTSW 6 23042751 missense probably damaging 1.00
R8157:Ptprz1 UTSW 6 23002540 missense probably damaging 1.00
R8159:Ptprz1 UTSW 6 23001663 missense probably benign
R8354:Ptprz1 UTSW 6 22999615 missense probably damaging 0.99
R8496:Ptprz1 UTSW 6 22972798 missense probably damaging 0.96
Z1176:Ptprz1 UTSW 6 23051995 missense probably damaging 0.99
Z1177:Ptprz1 UTSW 6 22999840 missense possibly damaging 0.51
Z1177:Ptprz1 UTSW 6 23052024 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTCAGAGGCAGCGTTCTCAGAC -3'
(R):5'- CATTGCTGAACAAAGATGGCAGCAC -3'

Sequencing Primer
(F):5'- AGCGTTCTCAGACACTGC -3'
(R):5'- GGGGACTTTTGCTCTTAAGCAAAC -3'
Posted On2014-04-24