Incidental Mutation 'R1626:Cblc'
ID172496
Institutional Source Beutler Lab
Gene Symbol Cblc
Ensembl Gene ENSMUSG00000040525
Gene NameCasitas B-lineage lymphoma c
Synonyms2310076I21Rik, Cbl3, 2310079L19Rik
MMRRC Submission 039663-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1626 (G1)
Quality Score182
Status Not validated
Chromosome7
Chromosomal Location19778881-19796809 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 19796502 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 94 (A94E)
Ref Sequence ENSEMBL: ENSMUSP00000039955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043822] [ENSMUST00000108449]
Predicted Effect probably damaging
Transcript: ENSMUST00000043822
AA Change: A94E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000039955
Gene: ENSMUSG00000040525
AA Change: A94E

DomainStartEndE-ValueType
Pfam:Cbl_N 13 144 2.6e-44 PFAM
Pfam:Cbl_N2 148 231 1.8e-35 PFAM
SH2 234 347 4.35e0 SMART
RING 350 388 1.92e-6 SMART
low complexity region 458 473 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108449
AA Change: A94E

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104088
Gene: ENSMUSG00000040525
AA Change: A94E

DomainStartEndE-ValueType
Pfam:Cbl_N 11 145 7.1e-20 PFAM
Pfam:Cbl_N2 147 231 2.3e-48 PFAM
SH2 234 333 5.28e0 SMART
low complexity region 414 429 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131276
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131602
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145755
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Cbl family of E3 ubiquitin ligases. Cbl proteins play important roles in cell signaling through the ubiquitination and subsequent downregulation of tyrosine kinases. Expression of this gene may be restricted to epithelial cells, and alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous null mice are viable, fertile, and show no abnormalities of the epithelium or other tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik T C 10: 21,621,672 Y71H possibly damaging Het
Acsl6 C A 11: 54,352,046 P628T probably damaging Het
Ak7 A G 12: 105,768,548 D591G probably benign Het
Anxa5 T C 3: 36,461,981 D66G probably damaging Het
Cacna1b G A 2: 24,606,709 T2283I probably damaging Het
Cand1 A T 10: 119,210,014 D995E possibly damaging Het
Cd48 G A 1: 171,682,119 C9Y probably benign Het
Chd9 A G 8: 90,994,596 K1004R probably benign Het
Cldn1 T C 16: 26,371,452 T59A probably damaging Het
Col11a1 G A 3: 114,131,569 G17D probably damaging Het
Cpeb1 A G 7: 81,436,247 V49A probably damaging Het
Cyp4b1 G T 4: 115,641,658 P109Q probably damaging Het
Dhrs7b T A 11: 60,844,256 F23I possibly damaging Het
Dnah9 C A 11: 66,085,267 A1319S probably benign Het
Egf A T 3: 129,686,215 V553D possibly damaging Het
Fbn1 T C 2: 125,341,279 D1760G probably damaging Het
Fbxo31 A G 8: 121,560,006 F178L probably damaging Het
Fstl4 C A 11: 53,000,290 S85* probably null Het
Gfm1 A G 3: 67,438,644 Y225C probably damaging Het
Gm10797 A T 10: 67,572,623 noncoding transcript Het
Heatr4 T A 12: 83,973,721 I499L probably benign Het
Hist1h3g G A 13: 23,535,551 V36M probably damaging Het
Ick A G 9: 78,150,637 Y156C probably damaging Het
Igfn1 A T 1: 135,968,967 M1287K probably benign Het
Inpp5b C A 4: 124,783,903 D385E probably damaging Het
Lrrc9 A G 12: 72,495,661 probably null Het
Ltb4r1 A G 14: 55,767,242 M1V probably null Het
Macf1 T C 4: 123,471,534 I3145V probably benign Het
Man2a2 T C 7: 80,367,702 N277S probably damaging Het
Megf6 G T 4: 154,177,121 V68L probably benign Het
Mgat4e A G 1: 134,541,278 Y343H probably benign Het
Noxred1 T C 12: 87,221,255 *367W probably null Het
Nupl1 A T 14: 60,242,627 L190* probably null Het
Olfml2a G T 2: 38,951,263 K270N probably damaging Het
Olfr368 A G 2: 37,332,762 probably null Het
Olfr850 A G 9: 19,478,199 L14P probably damaging Het
Phgdh G T 3: 98,316,409 Q359K probably benign Het
Plpp5 G T 8: 25,722,577 C200F possibly damaging Het
Pole A C 5: 110,293,369 I230L probably benign Het
Prtg A T 9: 72,844,911 D193V probably damaging Het
Ptgs2 G A 1: 150,103,868 probably null Het
Ptprz1 A T 6: 23,001,574 Q1221L probably benign Het
Rufy2 T C 10: 62,995,372 I204T probably benign Het
Rybp A G 6: 100,232,958 S115P possibly damaging Het
Samd13 A G 3: 146,662,726 V37A probably benign Het
Secisbp2l T G 2: 125,775,686 K24Q probably damaging Het
Sorbs2 A G 8: 45,769,854 Y198C probably damaging Het
Svil T G 18: 5,117,099 probably null Het
Ttc24 G T 3: 88,070,059 R127S probably benign Het
Ttn C T 2: 76,758,544 V21394M probably damaging Het
Tubal3 G T 13: 3,932,841 C207F probably damaging Het
Vmn2r16 A T 5: 109,363,577 D550V probably damaging Het
Vmn2r2 T A 3: 64,134,500 I265F possibly damaging Het
Zfp507 T C 7: 35,795,433 K62E probably damaging Het
Other mutations in Cblc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01510:Cblc APN 7 19785275 missense probably benign 0.00
R0583:Cblc UTSW 7 19792561 missense probably benign 0.41
R0847:Cblc UTSW 7 19790534 nonsense probably null
R1594:Cblc UTSW 7 19792546 missense probably damaging 1.00
R1719:Cblc UTSW 7 19790474 missense probably benign 0.00
R1894:Cblc UTSW 7 19792577 missense probably damaging 0.99
R2011:Cblc UTSW 7 19784822 missense probably benign 0.01
R2395:Cblc UTSW 7 19785380 missense probably damaging 1.00
R2852:Cblc UTSW 7 19780964 splice site probably null
R3832:Cblc UTSW 7 19792172 missense probably damaging 0.98
R4696:Cblc UTSW 7 19796482 missense probably damaging 1.00
R5159:Cblc UTSW 7 19785308 missense probably benign 0.01
R5328:Cblc UTSW 7 19792580 missense possibly damaging 0.68
R5487:Cblc UTSW 7 19784808 missense probably benign 0.06
R5659:Cblc UTSW 7 19792932 missense probably damaging 1.00
R6209:Cblc UTSW 7 19785305 missense possibly damaging 0.47
R6519:Cblc UTSW 7 19792863 missense probably damaging 1.00
R6841:Cblc UTSW 7 19792896 missense probably damaging 1.00
R7371:Cblc UTSW 7 19792903 missense probably benign 0.00
R7417:Cblc UTSW 7 19788974 missense probably benign 0.41
R7494:Cblc UTSW 7 19792812 missense possibly damaging 0.76
X0028:Cblc UTSW 7 19785273 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCCCAGGTTCAAGCTGATCTACAAAAG -3'
(R):5'- TGAAGTTGCTCCAGCGCCTAGAAG -3'

Sequencing Primer
(F):5'- TACTCCTGGGTCTGATGGAATAAAG -3'
(R):5'- GATCCCAGGATGGTCACG -3'
Posted On2014-04-24