Incidental Mutation 'R1626:Cpeb1'
ID172499
Institutional Source Beutler Lab
Gene Symbol Cpeb1
Ensembl Gene ENSMUSG00000025586
Gene Namecytoplasmic polyadenylation element binding protein 1
Synonyms
MMRRC Submission 039663-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1626 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location81347026-81455465 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 81436247 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 49 (V49A)
Ref Sequence ENSEMBL: ENSMUSP00000137079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098331] [ENSMUST00000130310] [ENSMUST00000178892]
Predicted Effect probably damaging
Transcript: ENSMUST00000098331
AA Change: V49A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095936
Gene: ENSMUSG00000025586
AA Change: V49A

DomainStartEndE-ValueType
low complexity region 112 126 N/A INTRINSIC
low complexity region 176 195 N/A INTRINSIC
RRM 311 386 2.6e-4 SMART
RRM_2 430 506 2.7e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124937
Predicted Effect probably damaging
Transcript: ENSMUST00000130310
AA Change: V44A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120139
Gene: ENSMUSG00000025586
AA Change: V44A

DomainStartEndE-ValueType
low complexity region 107 121 N/A INTRINSIC
low complexity region 171 190 N/A INTRINSIC
RRM 306 376 1.35e-1 SMART
RRM 420 496 6.36e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135177
Predicted Effect probably damaging
Transcript: ENSMUST00000178892
AA Change: V49A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137079
Gene: ENSMUSG00000025586
AA Change: V49A

DomainStartEndE-ValueType
Pfam:CEBP1_N 1 307 2.5e-153 PFAM
RRM 312 387 6.25e-2 SMART
RRM 431 507 6.36e-1 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytoplasmic polyadenylation element binding protein family. This highly conserved protein binds to a specific RNA sequence, called the cytoplasmic polyadenylation element, found in the 3' untranslated region of some mRNAs. The encoded protein functions in both the cytoplasm and the nucleus. It is involved in the regulation of mRNA translation, as well as processing of the 3' untranslated region, and may play a role in cell proliferation and tumorigenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a null allele are viable and overtly normal but display a developmental arrest of both female and male germ cells at the pachytene stage, defective synaptonemal complex formation, and impaired neuronal synaptic plasticity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik T C 10: 21,621,672 Y71H possibly damaging Het
Acsl6 C A 11: 54,352,046 P628T probably damaging Het
Ak7 A G 12: 105,768,548 D591G probably benign Het
Anxa5 T C 3: 36,461,981 D66G probably damaging Het
Cacna1b G A 2: 24,606,709 T2283I probably damaging Het
Cand1 A T 10: 119,210,014 D995E possibly damaging Het
Cblc G T 7: 19,796,502 A94E probably damaging Het
Cd48 G A 1: 171,682,119 C9Y probably benign Het
Chd9 A G 8: 90,994,596 K1004R probably benign Het
Cldn1 T C 16: 26,371,452 T59A probably damaging Het
Col11a1 G A 3: 114,131,569 G17D probably damaging Het
Cyp4b1 G T 4: 115,641,658 P109Q probably damaging Het
Dhrs7b T A 11: 60,844,256 F23I possibly damaging Het
Dnah9 C A 11: 66,085,267 A1319S probably benign Het
Egf A T 3: 129,686,215 V553D possibly damaging Het
Fbn1 T C 2: 125,341,279 D1760G probably damaging Het
Fbxo31 A G 8: 121,560,006 F178L probably damaging Het
Fstl4 C A 11: 53,000,290 S85* probably null Het
Gfm1 A G 3: 67,438,644 Y225C probably damaging Het
Gm10797 A T 10: 67,572,623 noncoding transcript Het
Heatr4 T A 12: 83,973,721 I499L probably benign Het
Hist1h3g G A 13: 23,535,551 V36M probably damaging Het
Ick A G 9: 78,150,637 Y156C probably damaging Het
Igfn1 A T 1: 135,968,967 M1287K probably benign Het
Inpp5b C A 4: 124,783,903 D385E probably damaging Het
Lrrc9 A G 12: 72,495,661 probably null Het
Ltb4r1 A G 14: 55,767,242 M1V probably null Het
Macf1 T C 4: 123,471,534 I3145V probably benign Het
Man2a2 T C 7: 80,367,702 N277S probably damaging Het
Megf6 G T 4: 154,177,121 V68L probably benign Het
Mgat4e A G 1: 134,541,278 Y343H probably benign Het
Noxred1 T C 12: 87,221,255 *367W probably null Het
Nupl1 A T 14: 60,242,627 L190* probably null Het
Olfml2a G T 2: 38,951,263 K270N probably damaging Het
Olfr368 A G 2: 37,332,762 probably null Het
Olfr850 A G 9: 19,478,199 L14P probably damaging Het
Phgdh G T 3: 98,316,409 Q359K probably benign Het
Plpp5 G T 8: 25,722,577 C200F possibly damaging Het
Pole A C 5: 110,293,369 I230L probably benign Het
Prtg A T 9: 72,844,911 D193V probably damaging Het
Ptgs2 G A 1: 150,103,868 probably null Het
Ptprz1 A T 6: 23,001,574 Q1221L probably benign Het
Rufy2 T C 10: 62,995,372 I204T probably benign Het
Rybp A G 6: 100,232,958 S115P possibly damaging Het
Samd13 A G 3: 146,662,726 V37A probably benign Het
Secisbp2l T G 2: 125,775,686 K24Q probably damaging Het
Sorbs2 A G 8: 45,769,854 Y198C probably damaging Het
Svil T G 18: 5,117,099 probably null Het
Ttc24 G T 3: 88,070,059 R127S probably benign Het
Ttn C T 2: 76,758,544 V21394M probably damaging Het
Tubal3 G T 13: 3,932,841 C207F probably damaging Het
Vmn2r16 A T 5: 109,363,577 D550V probably damaging Het
Vmn2r2 T A 3: 64,134,500 I265F possibly damaging Het
Zfp507 T C 7: 35,795,433 K62E probably damaging Het
Other mutations in Cpeb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Cpeb1 APN 7 81372181 missense probably benign
IGL01598:Cpeb1 APN 7 81361801 missense probably benign
IGL02214:Cpeb1 APN 7 81372057 missense possibly damaging 0.89
IGL02527:Cpeb1 APN 7 81359887 missense probably damaging 1.00
IGL02878:Cpeb1 APN 7 81357326 missense probably damaging 1.00
IGL03065:Cpeb1 APN 7 81436290 missense probably benign 0.39
IGL03305:Cpeb1 APN 7 81361716 missense probably benign 0.16
PIT4458001:Cpeb1 UTSW 7 81348432 missense probably damaging 1.00
R0391:Cpeb1 UTSW 7 81361725 missense possibly damaging 0.89
R0711:Cpeb1 UTSW 7 81351870 missense probably benign 0.01
R1723:Cpeb1 UTSW 7 81436226 missense probably benign 0.29
R1902:Cpeb1 UTSW 7 81372119 missense probably benign 0.03
R4614:Cpeb1 UTSW 7 81436270 missense possibly damaging 0.46
R4773:Cpeb1 UTSW 7 81355947 missense probably benign
R5256:Cpeb1 UTSW 7 81351839 missense probably damaging 1.00
R5750:Cpeb1 UTSW 7 81436351 missense probably benign 0.01
R5927:Cpeb1 UTSW 7 81361680 missense possibly damaging 0.69
R6000:Cpeb1 UTSW 7 81361680 missense possibly damaging 0.69
R6526:Cpeb1 UTSW 7 81361669 missense probably benign
RF005:Cpeb1 UTSW 7 81361806 missense possibly damaging 0.79
X0067:Cpeb1 UTSW 7 81359727 critical splice donor site probably null
Z1176:Cpeb1 UTSW 7 81359728 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CAGAGACTCAGTGTGCTCTTCACAG -3'
(R):5'- AGTAGTTGCATGGGAAATGTGCCAG -3'

Sequencing Primer
(F):5'- GGCCTCCAATAAGCCCTC -3'
(R):5'- ctgaagttcatgctgttgcc -3'
Posted On2014-04-24