Incidental Mutation 'R1626:Plpp5'
ID172500
Institutional Source Beutler Lab
Gene Symbol Plpp5
Ensembl Gene ENSMUSG00000031570
Gene Namephospholipid phosphatase 5
SynonymsPpapdc1b, 1810019D05Rik, 2310022A04Rik
MMRRC Submission 039663-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R1626 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location25720037-25724887 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 25722577 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 200 (C200F)
Ref Sequence ENSEMBL: ENSMUSP00000122437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033975] [ENSMUST00000068916] [ENSMUST00000084026] [ENSMUST00000124764] [ENSMUST00000133117] [ENSMUST00000138548] [ENSMUST00000139836] [ENSMUST00000142395] [ENSMUST00000145678] [ENSMUST00000210629] [ENSMUST00000211688]
Predicted Effect probably benign
Transcript: ENSMUST00000033975
SMART Domains Protein: ENSMUSP00000033975
Gene: ENSMUSG00000061313

DomainStartEndE-ValueType
low complexity region 12 25 N/A INTRINSIC
Pfam:WWE 40 112 7.5e-9 PFAM
Blast:DDHD 285 357 6e-28 BLAST
SAM 382 447 1.13e-11 SMART
DDHD 484 688 6.63e-75 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000068916
AA Change: C200F

PolyPhen 2 Score 0.728 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000067035
Gene: ENSMUSG00000031570
AA Change: C200F

DomainStartEndE-ValueType
acidPPc 85 224 3.08e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084026
SMART Domains Protein: ENSMUSP00000081040
Gene: ENSMUSG00000054823

DomainStartEndE-ValueType
low complexity region 128 151 N/A INTRINSIC
low complexity region 193 225 N/A INTRINSIC
PWWP 278 341 1.6e-12 SMART
low complexity region 680 701 N/A INTRINSIC
PHD 713 756 4.49e-7 SMART
PHD 761 808 5.82e-1 SMART
PHD 809 861 3.06e0 SMART
PHD 874 963 1e-4 SMART
PWWP 968 1030 8.62e-18 SMART
AWS 1103 1154 2.61e-17 SMART
SET 1155 1278 2.17e-41 SMART
PostSET 1279 1295 2.63e-3 SMART
low complexity region 1309 1326 N/A INTRINSIC
PHD 1332 1375 4.32e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124764
Predicted Effect probably benign
Transcript: ENSMUST00000133117
Predicted Effect probably benign
Transcript: ENSMUST00000138548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138879
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139120
Predicted Effect possibly damaging
Transcript: ENSMUST00000139836
AA Change: C200F

PolyPhen 2 Score 0.728 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000122437
Gene: ENSMUSG00000031570
AA Change: C200F

DomainStartEndE-ValueType
acidPPc 85 214 3.98e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142395
SMART Domains Protein: ENSMUSP00000117778
Gene: ENSMUSG00000054823

DomainStartEndE-ValueType
low complexity region 128 151 N/A INTRINSIC
low complexity region 193 225 N/A INTRINSIC
PWWP 278 341 1.6e-12 SMART
low complexity region 680 701 N/A INTRINSIC
PHD 713 756 4.49e-7 SMART
PHD 761 808 5.82e-1 SMART
PHD 809 861 3.06e0 SMART
PHD 874 963 1e-4 SMART
PWWP 968 1030 8.62e-18 SMART
AWS 1103 1154 2.61e-17 SMART
SET 1155 1278 2.17e-41 SMART
PostSET 1279 1295 2.63e-3 SMART
low complexity region 1309 1326 N/A INTRINSIC
PHD 1332 1375 4.32e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145678
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146762
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209373
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209375
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209483
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209843
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210624
Predicted Effect possibly damaging
Transcript: ENSMUST00000210629
AA Change: C132F

PolyPhen 2 Score 0.641 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000210777
Predicted Effect probably benign
Transcript: ENSMUST00000211688
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik T C 10: 21,621,672 Y71H possibly damaging Het
Acsl6 C A 11: 54,352,046 P628T probably damaging Het
Ak7 A G 12: 105,768,548 D591G probably benign Het
Anxa5 T C 3: 36,461,981 D66G probably damaging Het
Cacna1b G A 2: 24,606,709 T2283I probably damaging Het
Cand1 A T 10: 119,210,014 D995E possibly damaging Het
Cblc G T 7: 19,796,502 A94E probably damaging Het
Cd48 G A 1: 171,682,119 C9Y probably benign Het
Chd9 A G 8: 90,994,596 K1004R probably benign Het
Cldn1 T C 16: 26,371,452 T59A probably damaging Het
Col11a1 G A 3: 114,131,569 G17D probably damaging Het
Cpeb1 A G 7: 81,436,247 V49A probably damaging Het
Cyp4b1 G T 4: 115,641,658 P109Q probably damaging Het
Dhrs7b T A 11: 60,844,256 F23I possibly damaging Het
Dnah9 C A 11: 66,085,267 A1319S probably benign Het
Egf A T 3: 129,686,215 V553D possibly damaging Het
Fbn1 T C 2: 125,341,279 D1760G probably damaging Het
Fbxo31 A G 8: 121,560,006 F178L probably damaging Het
Fstl4 C A 11: 53,000,290 S85* probably null Het
Gfm1 A G 3: 67,438,644 Y225C probably damaging Het
Gm10797 A T 10: 67,572,623 noncoding transcript Het
Heatr4 T A 12: 83,973,721 I499L probably benign Het
Hist1h3g G A 13: 23,535,551 V36M probably damaging Het
Ick A G 9: 78,150,637 Y156C probably damaging Het
Igfn1 A T 1: 135,968,967 M1287K probably benign Het
Inpp5b C A 4: 124,783,903 D385E probably damaging Het
Lrrc9 A G 12: 72,495,661 probably null Het
Ltb4r1 A G 14: 55,767,242 M1V probably null Het
Macf1 T C 4: 123,471,534 I3145V probably benign Het
Man2a2 T C 7: 80,367,702 N277S probably damaging Het
Megf6 G T 4: 154,177,121 V68L probably benign Het
Mgat4e A G 1: 134,541,278 Y343H probably benign Het
Noxred1 T C 12: 87,221,255 *367W probably null Het
Nupl1 A T 14: 60,242,627 L190* probably null Het
Olfml2a G T 2: 38,951,263 K270N probably damaging Het
Olfr368 A G 2: 37,332,762 probably null Het
Olfr850 A G 9: 19,478,199 L14P probably damaging Het
Phgdh G T 3: 98,316,409 Q359K probably benign Het
Pole A C 5: 110,293,369 I230L probably benign Het
Prtg A T 9: 72,844,911 D193V probably damaging Het
Ptgs2 G A 1: 150,103,868 probably null Het
Ptprz1 A T 6: 23,001,574 Q1221L probably benign Het
Rufy2 T C 10: 62,995,372 I204T probably benign Het
Rybp A G 6: 100,232,958 S115P possibly damaging Het
Samd13 A G 3: 146,662,726 V37A probably benign Het
Secisbp2l T G 2: 125,775,686 K24Q probably damaging Het
Sorbs2 A G 8: 45,769,854 Y198C probably damaging Het
Svil T G 18: 5,117,099 probably null Het
Ttc24 G T 3: 88,070,059 R127S probably benign Het
Ttn C T 2: 76,758,544 V21394M probably damaging Het
Tubal3 G T 13: 3,932,841 C207F probably damaging Het
Vmn2r16 A T 5: 109,363,577 D550V probably damaging Het
Vmn2r2 T A 3: 64,134,500 I265F possibly damaging Het
Zfp507 T C 7: 35,795,433 K62E probably damaging Het
Other mutations in Plpp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Plpp5 APN 8 25720558 missense probably damaging 0.99
IGL01588:Plpp5 APN 8 25724168 missense probably damaging 0.99
IGL02539:Plpp5 APN 8 25724188 missense probably benign
IGL02807:Plpp5 APN 8 25721165 splice site probably benign
R0362:Plpp5 UTSW 8 25724192 missense probably benign 0.00
R4009:Plpp5 UTSW 8 25720311 missense probably damaging 1.00
R4030:Plpp5 UTSW 8 25720604 missense probably damaging 0.98
R7178:Plpp5 UTSW 8 25720579 missense probably benign 0.32
R7529:Plpp5 UTSW 8 25724206 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGACCTTTGTAGCTCCCAGGAACC -3'
(R):5'- ACTCAGTACAATCCACAGGCTGTCC -3'

Sequencing Primer
(F):5'- GGTGCTGTAGACTTCTCACCATAAG -3'
(R):5'- CACAGGCTGTCCCCTCC -3'
Posted On2014-04-24