Mutagenetix > Incidental Mutations

Incidental Mutation 'R1627:Slco5a1'

172533

Institutional Source

Beutler Lab

Gene Symbol

Slco5a1

Ensembl Gene

ENSMUSG00000025938

Gene Name

solute carrier organic anion transporter family, member 5A1

Synonyms

A630033C23Rik

MMRRC Submission

039664-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.156) question?

Stock #

R1627 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

12866549-12992650 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 12990383 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Arginine at position 38 (P38R)

Ref Sequence

ENSEMBL: ENSMUSP00000140091 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115402] [ENSMUST00000115403] [ENSMUST00000136197] [ENSMUST00000146763] [ENSMUST00000147606] [ENSMUST00000188454]

Predicted Effect

probably damaging
Transcript: ENSMUST00000115402
AA Change: P38R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000111061
Gene: ENSMUSG00000025938
AA Change: P38R

Domain	Start	End	E-Value	Type
low complexity region	80	93	N/A	INTRINSIC
Pfam:MFS_1	137	548	3e-28	PFAM
KAZAL	559	602	3.26e-2	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000115403
AA Change: P38R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000111062
Gene: ENSMUSG00000025938
AA Change: P38R

Domain	Start	End	E-Value	Type
low complexity region	80	93	N/A	INTRINSIC
Pfam:MFS_1	137	547	2.8e-28	PFAM
KAZAL	559	602	3.26e-2	SMART
transmembrane domain	737	759	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000136197
AA Change: P38R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000139533
Gene: ENSMUSG00000025938
AA Change: P38R

Domain	Start	End	E-Value	Type
low complexity region	80	93	N/A	INTRINSIC
Pfam:MFS_1	137	548	3.6e-27	PFAM
KAZAL	559	601	4.3e-4	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000146763
AA Change: P38R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000139586
Gene: ENSMUSG00000025938
AA Change: P38R

Domain	Start	End	E-Value	Type
low complexity region	80	93	N/A	INTRINSIC
Pfam:OATP	130	352	8.4e-72	PFAM
Pfam:MFS_1	137	332	1.6e-13	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000147606
AA Change: P38R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000140658
Gene: ENSMUSG00000025938
AA Change: P38R

Domain	Start	End	E-Value	Type
low complexity region	80	93	N/A	INTRINSIC
Pfam:OATP	130	478	1.5e-105	PFAM
Pfam:MFS_1	137	476	2.3e-24	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000188454
AA Change: P38R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000140091
Gene: ENSMUSG00000025938
AA Change: P38R

Domain	Start	End	E-Value	Type
low complexity region	80	93	N/A	INTRINSIC
Pfam:MFS_1	137	548	4.1e-28	PFAM
KAZAL	559	602	3.26e-2	SMART
transmembrane domain	737	759	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191566

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.3%
20x: 89.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 12 transmembrane domain protein that is a member of the solute carrier organic anion transporter superfamily. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2009]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg3	A	G	5: 104,936,014	M630T	probably benign	Het
Anpep	T	C	7: 79,842,011	I81V	probably benign	Het
Bub1	A	G	2: 127,809,013	S627P	probably benign	Het
C1s1	T	A	6: 124,537,480	N139I	probably damaging	Het
Car6	A	T	4: 150,192,578	V152D	probably damaging	Het
Cdh19	C	A	1: 110,919,645	M411I	probably benign	Het
Cep95	A	G	11: 106,809,705	E322G	probably damaging	Het
Chek1	C	A	9: 36,714,441	V303L	probably benign	Het
Dctn1	T	A	6: 83,195,082	I818N	probably damaging	Het
Dscaml1	T	C	9: 45,753,147	S2107P	probably damaging	Het
Dusp14	A	G	11: 84,048,771	I148T	probably damaging	Het
Eps15	A	G	4: 109,370,557	D645G	probably damaging	Het
Etl4	A	G	2: 20,801,579	N1153S	possibly damaging	Het
Fer1l6	A	G	15: 58,641,879	D1541G	probably benign	Het
Gm14496	A	G	2: 181,998,778	S513G	probably damaging	Het
H2-D1	G	T	17: 35,263,495	A64S	possibly damaging	Het
Hsd17b2	T	A	8: 117,702,170	F59I	possibly damaging	Het
Itgb7	T	G	15: 102,223,476	Q224P	probably damaging	Het
Jak1	A	G	4: 101,191,624		probably null	Het
Kdm1b	G	A	13: 47,064,231		probably null	Het
Lrp8	A	G	4: 107,854,416	I466V	probably damaging	Het
Mga	A	G	2: 119,964,562	D2909G	probably damaging	Het
Nol8	T	C	13: 49,661,504	S345P	probably benign	Het
Nup210l	T	C	3: 90,144,169	M540T	probably benign	Het
Obscn	C	T	11: 59,112,638	R1370H	probably benign	Het
Olfr1368	A	G	13: 21,142,955	F34S	probably damaging	Het
Pbx3	A	G	2: 34,175,953	V375A	probably benign	Het
Ppp1r9a	T	C	6: 4,906,168	V241A	possibly damaging	Het
Psmd6	C	T	14: 14,112,539	V354M	probably damaging	Het
Rab2a	T	C	4: 8,578,481	F94L	probably damaging	Het
Rev1	T	C	1: 38,055,490	D949G	probably damaging	Het
Ric8a	A	G	7: 140,858,178	D110G	probably damaging	Het
Rlf	A	T	4: 121,150,000	D594E	probably benign	Het
Sept1	C	A	7: 127,218,058		probably null	Het
Snx33	C	A	9: 56,925,957	R276L	probably damaging	Het
Taf11	A	T	17: 27,905,279	D101E	probably benign	Het
Ttn	A	G	2: 76,934,220	S3168P	probably damaging	Het
Uggt2	T	C	14: 119,057,663	E41G	possibly damaging	Het
Vmn2r80	A	G	10: 79,194,415	R692G	probably damaging	Het
Zfp763	A	T	17: 33,021,784	W24R	probably damaging	Het

Other mutations in Slco5a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02264:Slco5a1	APN	1	12871995	missense	probably benign	0.01
IGL02330:Slco5a1	APN	1	12939060	missense	probably damaging	1.00
IGL02660:Slco5a1	APN	1	12989636	missense	probably damaging	1.00
IGL02904:Slco5a1	APN	1	12921097	missense	probably damaging	0.98
IGL02972:Slco5a1	APN	1	12990155	nonsense	probably null
IGL03100:Slco5a1	APN	1	12879280	missense	possibly damaging	0.67
IGL03270:Slco5a1	APN	1	12872028	missense	probably benign
R0969:Slco5a1	UTSW	1	12989892	missense	probably damaging	1.00
R1337:Slco5a1	UTSW	1	12939142	missense	probably benign	0.01
R1434:Slco5a1	UTSW	1	12871908	missense	probably benign	0.00
R1767:Slco5a1	UTSW	1	12989615	missense	probably damaging	1.00
R1893:Slco5a1	UTSW	1	12894472	missense	probably damaging	1.00
R1894:Slco5a1	UTSW	1	12872259	missense	probably damaging	1.00
R2301:Slco5a1	UTSW	1	12879262	missense	probably damaging	0.98
R2302:Slco5a1	UTSW	1	12879262	missense	probably damaging	0.98
R2303:Slco5a1	UTSW	1	12879262	missense	probably damaging	0.98
R2304:Slco5a1	UTSW	1	12879262	missense	probably damaging	0.98
R2349:Slco5a1	UTSW	1	12921152	missense	probably damaging	1.00
R2351:Slco5a1	UTSW	1	12989934	missense	probably benign	0.05
R3079:Slco5a1	UTSW	1	12879262	missense	probably damaging	0.98
R3949:Slco5a1	UTSW	1	12989609	missense	probably damaging	1.00
R4197:Slco5a1	UTSW	1	12894516	missense	probably damaging	1.00
R4380:Slco5a1	UTSW	1	12939168	missense	probably damaging	0.96
R4532:Slco5a1	UTSW	1	12879223	missense	probably damaging	1.00
R4750:Slco5a1	UTSW	1	12879280	missense	probably damaging	1.00
R5891:Slco5a1	UTSW	1	12990402	missense	probably benign	0.04
R6024:Slco5a1	UTSW	1	12944070	missense	probably damaging	1.00
R6332:Slco5a1	UTSW	1	12921185	missense	probably benign	0.27
R6492:Slco5a1	UTSW	1	12989927	missense	probably damaging	1.00
R6860:Slco5a1	UTSW	1	12881196	intron	probably benign
R6994:Slco5a1	UTSW	1	12881393	missense	probably damaging	1.00
R7121:Slco5a1	UTSW	1	12990437	missense	probably benign	0.00
R7747:Slco5a1	UTSW	1	12990122	missense	probably benign	0.05
R7802:Slco5a1	UTSW	1	12990476	missense	possibly damaging	0.76
R7895:Slco5a1	UTSW	1	12989703	missense	possibly damaging	0.52
R7984:Slco5a1	UTSW	1	12881384	missense	probably damaging	1.00
R8172:Slco5a1	UTSW	1	12990266	nonsense	probably null
RF010:Slco5a1	UTSW	1	12871947	missense	probably damaging	1.00
X0065:Slco5a1	UTSW	1	12872212	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCACACTAAGAAGCAGCGAGAATC -3'
(R):5'- CGTTCAGGTGGATGAAAAGTGCCG -3'

Sequencing Primer
(F):5'- ACAGTCCATGAGTTCCGTTG -3'
(R):5'- CCGGAGGCCTTATATGGAATCA -3'

Posted On

2014-04-24