Incidental Mutation 'R1627:Nup210l'
ID 172544
Institutional Source Beutler Lab
Gene Symbol Nup210l
Ensembl Gene ENSMUSG00000027939
Gene Name nucleoporin 210-like
Synonyms 4930548O11Rik, R26-EGFP, Tg(Gt(ROSA)26Sor-EGFP)130910Eps
MMRRC Submission 039664-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.350) question?
Stock # R1627 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 90104132-90212048 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 90144169 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 540 (M540T)
Ref Sequence ENSEMBL: ENSMUSP00000143368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029548] [ENSMUST00000200410]
AlphaFold Q9D2F7
Predicted Effect probably benign
Transcript: ENSMUST00000029548
AA Change: M540T

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000029548
Gene: ENSMUSG00000027939
AA Change: M540T

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
BID_2 457 536 2.05e1 SMART
Blast:S1 949 1023 2e-16 BLAST
BID_2 1077 1152 4.51e-11 SMART
Blast:BID_2 1468 1550 7e-15 BLAST
transmembrane domain 1807 1829 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200410
AA Change: M540T

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000143368
Gene: ENSMUSG00000027939
AA Change: M540T

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
BID_2 457 536 6.9e-2 SMART
Blast:S1 938 1023 9e-17 BLAST
BID_2 1077 1152 1.5e-13 SMART
Blast:BID_2 1468 1550 7e-15 BLAST
transmembrane domain 1807 1829 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a transgene insertion exhibit male infertility, asthenozoospermia, teratozoospermia, azoospermia, and seminiferous tubule degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 A G 5: 104,936,014 M630T probably benign Het
Anpep T C 7: 79,842,011 I81V probably benign Het
Bub1 A G 2: 127,809,013 S627P probably benign Het
C1s1 T A 6: 124,537,480 N139I probably damaging Het
Car6 A T 4: 150,192,578 V152D probably damaging Het
Cdh19 C A 1: 110,919,645 M411I probably benign Het
Cep95 A G 11: 106,809,705 E322G probably damaging Het
Chek1 C A 9: 36,714,441 V303L probably benign Het
Dctn1 T A 6: 83,195,082 I818N probably damaging Het
Dscaml1 T C 9: 45,753,147 S2107P probably damaging Het
Dusp14 A G 11: 84,048,771 I148T probably damaging Het
Eps15 A G 4: 109,370,557 D645G probably damaging Het
Etl4 A G 2: 20,801,579 N1153S possibly damaging Het
Fer1l6 A G 15: 58,641,879 D1541G probably benign Het
Gm14496 A G 2: 181,998,778 S513G probably damaging Het
H2-D1 G T 17: 35,263,495 A64S possibly damaging Het
Hsd17b2 T A 8: 117,702,170 F59I possibly damaging Het
Itgb7 T G 15: 102,223,476 Q224P probably damaging Het
Jak1 A G 4: 101,191,624 probably null Het
Kdm1b G A 13: 47,064,231 probably null Het
Lrp8 A G 4: 107,854,416 I466V probably damaging Het
Mga A G 2: 119,964,562 D2909G probably damaging Het
Nol8 T C 13: 49,661,504 S345P probably benign Het
Obscn C T 11: 59,112,638 R1370H probably benign Het
Olfr1368 A G 13: 21,142,955 F34S probably damaging Het
Pbx3 A G 2: 34,175,953 V375A probably benign Het
Ppp1r9a T C 6: 4,906,168 V241A possibly damaging Het
Psmd6 C T 14: 14,112,539 V354M probably damaging Het
Rab2a T C 4: 8,578,481 F94L probably damaging Het
Rev1 T C 1: 38,055,490 D949G probably damaging Het
Ric8a A G 7: 140,858,178 D110G probably damaging Het
Rlf A T 4: 121,150,000 D594E probably benign Het
Sept1 C A 7: 127,218,058 probably null Het
Slco5a1 G C 1: 12,990,383 P38R probably damaging Het
Snx33 C A 9: 56,925,957 R276L probably damaging Het
Taf11 A T 17: 27,905,279 D101E probably benign Het
Ttn A G 2: 76,934,220 S3168P probably damaging Het
Uggt2 T C 14: 119,057,663 E41G possibly damaging Het
Vmn2r80 A G 10: 79,194,415 R692G probably damaging Het
Zfp763 A T 17: 33,021,784 W24R probably damaging Het
Other mutations in Nup210l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Nup210l APN 3 90190849 splice site probably benign
IGL00813:Nup210l APN 3 90132418 missense probably benign 0.00
IGL01375:Nup210l APN 3 90159893 missense probably damaging 0.96
IGL01731:Nup210l APN 3 90154566 missense probably damaging 1.00
IGL01786:Nup210l APN 3 90122776 nonsense probably null
IGL01958:Nup210l APN 3 90203924 missense possibly damaging 0.74
IGL02094:Nup210l APN 3 90180213 critical splice donor site probably null
IGL02120:Nup210l APN 3 90136862 missense probably damaging 1.00
IGL02313:Nup210l APN 3 90122792 missense probably damaging 1.00
IGL02336:Nup210l APN 3 90181552 critical splice donor site probably null
IGL02348:Nup210l APN 3 90104164 utr 5 prime probably benign
IGL02372:Nup210l APN 3 90201971 missense possibly damaging 0.80
IGL02557:Nup210l APN 3 90124230 missense probably damaging 1.00
IGL02559:Nup210l APN 3 90159953 missense probably benign 0.02
IGL02738:Nup210l APN 3 90136850 missense possibly damaging 0.80
IGL03231:Nup210l APN 3 90189545 missense probably damaging 1.00
IGL03257:Nup210l APN 3 90180148 critical splice acceptor site probably null
IGL03388:Nup210l APN 3 90170044 missense probably damaging 1.00
IGL03134:Nup210l UTSW 3 90190887 missense possibly damaging 0.85
R0003:Nup210l UTSW 3 90119911 missense probably damaging 1.00
R0040:Nup210l UTSW 3 90181905 missense probably damaging 1.00
R0083:Nup210l UTSW 3 90189575 missense probably damaging 1.00
R0090:Nup210l UTSW 3 90211779 missense probably benign 0.00
R0108:Nup210l UTSW 3 90189575 missense probably damaging 1.00
R0142:Nup210l UTSW 3 90172113 missense probably damaging 1.00
R0306:Nup210l UTSW 3 90207368 missense probably benign 0.13
R0332:Nup210l UTSW 3 90132309 splice site probably benign
R0346:Nup210l UTSW 3 90189438 missense probably damaging 1.00
R0463:Nup210l UTSW 3 90180211 missense probably null 1.00
R0622:Nup210l UTSW 3 90167740 missense probably damaging 0.98
R0765:Nup210l UTSW 3 90119877 missense probably damaging 0.99
R0990:Nup210l UTSW 3 90211925 missense probably benign 0.00
R1014:Nup210l UTSW 3 90170048 missense possibly damaging 0.62
R1036:Nup210l UTSW 3 90192940 splice site probably benign
R1177:Nup210l UTSW 3 90202003 missense probably benign 0.11
R1183:Nup210l UTSW 3 90159945 missense probably benign 0.04
R1188:Nup210l UTSW 3 90198179 missense probably benign 0.16
R1457:Nup210l UTSW 3 90190972 missense possibly damaging 0.68
R1471:Nup210l UTSW 3 90170562 missense probably benign
R1778:Nup210l UTSW 3 90189486 missense probably damaging 0.99
R1827:Nup210l UTSW 3 90154557 missense probably damaging 1.00
R1843:Nup210l UTSW 3 90172086 missense probably damaging 0.96
R1858:Nup210l UTSW 3 90154499 missense probably damaging 0.97
R1942:Nup210l UTSW 3 90151237 missense probably benign 0.01
R2015:Nup210l UTSW 3 90185432 missense probably damaging 1.00
R2113:Nup210l UTSW 3 90190974 missense possibly damaging 0.48
R2944:Nup210l UTSW 3 90181545 missense probably damaging 1.00
R3736:Nup210l UTSW 3 90120013 missense probably damaging 1.00
R3740:Nup210l UTSW 3 90207394 missense probably benign 0.08
R3741:Nup210l UTSW 3 90207394 missense probably benign 0.08
R3742:Nup210l UTSW 3 90207394 missense probably benign 0.08
R3771:Nup210l UTSW 3 90119894 nonsense probably null
R3773:Nup210l UTSW 3 90119894 nonsense probably null
R3879:Nup210l UTSW 3 90185473 missense probably damaging 1.00
R3882:Nup210l UTSW 3 90124210 missense probably benign 0.19
R3953:Nup210l UTSW 3 90193054 missense possibly damaging 0.89
R3954:Nup210l UTSW 3 90193054 missense possibly damaging 0.89
R3955:Nup210l UTSW 3 90193054 missense possibly damaging 0.89
R3956:Nup210l UTSW 3 90193054 missense possibly damaging 0.89
R4200:Nup210l UTSW 3 90119911 missense probably damaging 1.00
R4290:Nup210l UTSW 3 90207326 missense probably benign 0.00
R4328:Nup210l UTSW 3 90175835 splice site probably null
R4629:Nup210l UTSW 3 90167875 missense probably benign 0.21
R4629:Nup210l UTSW 3 90190874 nonsense probably null
R4897:Nup210l UTSW 3 90193071 missense probably damaging 1.00
R4906:Nup210l UTSW 3 90170030 missense probably benign 0.06
R4966:Nup210l UTSW 3 90106901 missense probably benign 0.00
R5004:Nup210l UTSW 3 90180165 nonsense probably null
R5237:Nup210l UTSW 3 90180198 missense probably benign 0.00
R5499:Nup210l UTSW 3 90174370 missense probably damaging 1.00
R5522:Nup210l UTSW 3 90154665 missense probably benign 0.10
R5627:Nup210l UTSW 3 90144250 missense probably damaging 0.97
R5678:Nup210l UTSW 3 90190959 missense probably damaging 0.99
R5726:Nup210l UTSW 3 90129207 splice site probably null
R5792:Nup210l UTSW 3 90199857 missense probably damaging 1.00
R6129:Nup210l UTSW 3 90104176 missense probably benign 0.00
R6272:Nup210l UTSW 3 90170024 missense possibly damaging 0.57
R6290:Nup210l UTSW 3 90119909 nonsense probably null
R6293:Nup210l UTSW 3 90115064 missense probably damaging 1.00
R6446:Nup210l UTSW 3 90172068 missense probably damaging 1.00
R6698:Nup210l UTSW 3 90182508 missense possibly damaging 0.57
R6855:Nup210l UTSW 3 90136924 missense probably benign 0.01
R6895:Nup210l UTSW 3 90159924 missense probably damaging 0.97
R6899:Nup210l UTSW 3 90167897 missense possibly damaging 0.77
R6978:Nup210l UTSW 3 90154566 missense possibly damaging 0.86
R6980:Nup210l UTSW 3 90119927 missense probably benign 0.04
R7038:Nup210l UTSW 3 90159947 missense probably damaging 1.00
R7273:Nup210l UTSW 3 90118547 missense probably benign 0.04
R7450:Nup210l UTSW 3 90115188 critical splice donor site probably null
R7514:Nup210l UTSW 3 90210459 critical splice donor site probably null
R7658:Nup210l UTSW 3 90211993 missense probably benign 0.43
R7735:Nup210l UTSW 3 90185576 missense probably damaging 1.00
R7772:Nup210l UTSW 3 90159926 missense probably damaging 1.00
R7800:Nup210l UTSW 3 90134597 missense probably damaging 1.00
R7840:Nup210l UTSW 3 90122729 missense probably benign 0.08
R7847:Nup210l UTSW 3 90151123 missense probably benign
R7848:Nup210l UTSW 3 90203905 missense probably benign 0.01
R8084:Nup210l UTSW 3 90136058 missense probably benign 0.15
R8121:Nup210l UTSW 3 90115121 missense probably damaging 1.00
R8421:Nup210l UTSW 3 90203867 missense probably damaging 1.00
R8458:Nup210l UTSW 3 90185567 missense probably null 1.00
R8701:Nup210l UTSW 3 90122814 missense probably benign 0.41
R8720:Nup210l UTSW 3 90210374 missense probably benign 0.00
R8770:Nup210l UTSW 3 90118543 missense probably damaging 1.00
R8896:Nup210l UTSW 3 90118625 missense probably damaging 1.00
R9033:Nup210l UTSW 3 90198089 missense probably benign
R9371:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9373:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9381:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9426:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9427:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9501:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9523:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9574:Nup210l UTSW 3 90210386 missense probably benign
R9612:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9654:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9660:Nup210l UTSW 3 90198095 missense probably benign 0.30
R9660:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9662:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9682:Nup210l UTSW 3 90144162 missense possibly damaging 0.79
R9729:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9750:Nup210l UTSW 3 90210352 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CATGCACAAGGATCTGCATTCAACTC -3'
(R):5'- GGTGGTAAAAGCTTAGCCTTGCCTTC -3'

Sequencing Primer
(F):5'- ctgaggatgaacttgactctattg -3'
(R):5'- GCCTTGCCTTCTTTAAAAAGAGTG -3'
Posted On 2014-04-24