Incidental Mutation 'R1627:Jak1'
ID172546
Institutional Source Beutler Lab
Gene Symbol Jak1
Ensembl Gene ENSMUSG00000028530
Gene NameJanus kinase 1
Synonyms
MMRRC Submission 039664-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1627 (G1)
Quality Score223
Status Not validated
Chromosome4
Chromosomal Location101152367-101265282 bp(-) (GRCm38)
Type of Mutationsplice site (2 bp from exon)
DNA Base Change (assembly) A to G at 101191624 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102781] [ENSMUST00000149297] [ENSMUST00000149297]
Predicted Effect probably benign
Transcript: ENSMUST00000102781
AA Change: M19T

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000099842
Gene: ENSMUSG00000028530
AA Change: M19T

DomainStartEndE-ValueType
B41 32 286 2.45e-58 SMART
Blast:B41 291 420 4e-51 BLAST
SH2 437 531 1.85e-13 SMART
STYKc 582 844 6.72e-14 SMART
TyrKc 874 1148 9.01e-122 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104489
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132292
Predicted Effect probably null
Transcript: ENSMUST00000149297
Predicted Effect probably null
Transcript: ENSMUST00000149297
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155328
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein that is a member of a class of protein-tyrosine kinases (PTK) characterized by the presence of a second phosphotransferase-related domain immediately N-terminal to the PTK domain. The encoded kinase phosphorylates STAT proteins (signal transducers and activators of transcription) and plays a key role in interferon-alpha/beta and interferon-gamma signal transduction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for disruption of this gene die within the first 24 hours after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 A G 5: 104,936,014 M630T probably benign Het
Anpep T C 7: 79,842,011 I81V probably benign Het
Bub1 A G 2: 127,809,013 S627P probably benign Het
C1s1 T A 6: 124,537,480 N139I probably damaging Het
Car6 A T 4: 150,192,578 V152D probably damaging Het
Cdh19 C A 1: 110,919,645 M411I probably benign Het
Cep95 A G 11: 106,809,705 E322G probably damaging Het
Chek1 C A 9: 36,714,441 V303L probably benign Het
Dctn1 T A 6: 83,195,082 I818N probably damaging Het
Dscaml1 T C 9: 45,753,147 S2107P probably damaging Het
Dusp14 A G 11: 84,048,771 I148T probably damaging Het
Eps15 A G 4: 109,370,557 D645G probably damaging Het
Etl4 A G 2: 20,801,579 N1153S possibly damaging Het
Fer1l6 A G 15: 58,641,879 D1541G probably benign Het
Gm14496 A G 2: 181,998,778 S513G probably damaging Het
H2-D1 G T 17: 35,263,495 A64S possibly damaging Het
Hsd17b2 T A 8: 117,702,170 F59I possibly damaging Het
Itgb7 T G 15: 102,223,476 Q224P probably damaging Het
Kdm1b G A 13: 47,064,231 probably null Het
Lrp8 A G 4: 107,854,416 I466V probably damaging Het
Mga A G 2: 119,964,562 D2909G probably damaging Het
Nol8 T C 13: 49,661,504 S345P probably benign Het
Nup210l T C 3: 90,144,169 M540T probably benign Het
Obscn C T 11: 59,112,638 R1370H probably benign Het
Olfr1368 A G 13: 21,142,955 F34S probably damaging Het
Pbx3 A G 2: 34,175,953 V375A probably benign Het
Ppp1r9a T C 6: 4,906,168 V241A possibly damaging Het
Psmd6 C T 14: 14,112,539 V354M probably damaging Het
Rab2a T C 4: 8,578,481 F94L probably damaging Het
Rev1 T C 1: 38,055,490 D949G probably damaging Het
Ric8a A G 7: 140,858,178 D110G probably damaging Het
Rlf A T 4: 121,150,000 D594E probably benign Het
Sept1 C A 7: 127,218,058 probably null Het
Slco5a1 G C 1: 12,990,383 P38R probably damaging Het
Snx33 C A 9: 56,925,957 R276L probably damaging Het
Taf11 A T 17: 27,905,279 D101E probably benign Het
Ttn A G 2: 76,934,220 S3168P probably damaging Het
Uggt2 T C 14: 119,057,663 E41G possibly damaging Het
Vmn2r80 A G 10: 79,194,415 R692G probably damaging Het
Zfp763 A T 17: 33,021,784 W24R probably damaging Het
Other mutations in Jak1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Jak1 APN 4 101154629 missense probably damaging 1.00
IGL00990:Jak1 APN 4 101171357 missense probably damaging 1.00
IGL01341:Jak1 APN 4 101175093 missense probably damaging 0.98
IGL02102:Jak1 APN 4 101159086 missense probably benign 0.11
IGL02720:Jak1 APN 4 101164450 splice site probably benign
IGL03301:Jak1 APN 4 101175173 missense probably damaging 1.00
Back UTSW 4 101174211 critical splice acceptor site probably null
Behind UTSW 4 101154537 critical splice donor site probably null
Lady UTSW 4 101179541 nonsense probably null
BB006:Jak1 UTSW 4 101154645 missense probably damaging 1.00
BB016:Jak1 UTSW 4 101154645 missense probably damaging 1.00
PIT4377001:Jak1 UTSW 4 101179551 missense probably benign 0.19
R0308:Jak1 UTSW 4 101154535 splice site probably null
R0544:Jak1 UTSW 4 101191625 missense probably benign
R1212:Jak1 UTSW 4 101189094 missense probably damaging 1.00
R1519:Jak1 UTSW 4 101162922 missense probably damaging 0.99
R1760:Jak1 UTSW 4 101162929 missense probably benign 0.04
R2116:Jak1 UTSW 4 101179675 missense probably damaging 0.98
R2980:Jak1 UTSW 4 101179781 missense probably damaging 0.99
R3738:Jak1 UTSW 4 101191468 unclassified probably benign
R3779:Jak1 UTSW 4 101156490 missense probably benign 0.40
R4172:Jak1 UTSW 4 101159132 missense probably benign 0.08
R4505:Jak1 UTSW 4 101154603 missense probably benign
R4602:Jak1 UTSW 4 101179594 missense possibly damaging 0.83
R4755:Jak1 UTSW 4 101174157 missense probably damaging 1.00
R4836:Jak1 UTSW 4 101155066 missense probably damaging 0.97
R4908:Jak1 UTSW 4 101179714 missense probably damaging 1.00
R5116:Jak1 UTSW 4 101155113 missense probably benign
R6190:Jak1 UTSW 4 101175128 missense probably damaging 1.00
R6339:Jak1 UTSW 4 101161926 missense probably damaging 0.99
R6500:Jak1 UTSW 4 101181933 missense probably benign 0.43
R6551:Jak1 UTSW 4 101193843 start gained probably benign
R6895:Jak1 UTSW 4 101154537 critical splice donor site probably null
R7163:Jak1 UTSW 4 101175188 missense probably damaging 1.00
R7204:Jak1 UTSW 4 101175135 missense probably benign 0.02
R7361:Jak1 UTSW 4 101184339 missense possibly damaging 0.86
R7408:Jak1 UTSW 4 101175182 missense probably damaging 0.96
R7513:Jak1 UTSW 4 101191651 missense probably damaging 0.96
R7617:Jak1 UTSW 4 101174211 critical splice acceptor site probably null
R7779:Jak1 UTSW 4 101160142 missense probably benign
R7929:Jak1 UTSW 4 101154645 missense probably damaging 1.00
R8282:Jak1 UTSW 4 101179541 nonsense probably null
Z1176:Jak1 UTSW 4 101163681 missense probably damaging 1.00
Z1176:Jak1 UTSW 4 101163722 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TGGCTTCCAGAACTCACACCTTGC -3'
(R):5'- TGACTCCAGAGGAGAGCTTCCAAC -3'

Sequencing Primer
(F):5'- GAACTCACACCTTGCTCTCAG -3'
(R):5'- GAGAGCTTCCAACTACAACTAGTATG -3'
Posted On2014-04-24