Mutagenetix > Incidental Mutations

Incidental Mutation 'R1627:Dctn1'

172555

Institutional Source

Beutler Lab

Gene Symbol

Dctn1

Ensembl Gene

ENSMUSG00000031865

Gene Name

dynactin 1

Synonyms

p150, Glued, p150

MMRRC Submission

039664-MU

Accession Numbers

Ncbi RefSeq: NM_007835.2, NM_001198866.1, NM_001198867.1; MGI: 107745

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1627 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

83165920-83200117 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 83195082 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 818 (I818N)

Ref Sequence

ENSEMBL: ENSMUSP00000109540 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077407] [ENSMUST00000113907] [ENSMUST00000113913] [ENSMUST00000113918] [ENSMUST00000113919]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000077407
AA Change: I915N

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000076623
Gene: ENSMUSG00000031865
AA Change: I915N

Domain	Start	End	E-Value	Type
CAP_GLY	12	78	5.52e-31	SMART
low complexity region	124	147	N/A	INTRINSIC
low complexity region	148	177	N/A	INTRINSIC
SCOP:d1fxkc_	185	337	3e-3	SMART
low complexity region	363	379	N/A	INTRINSIC
Pfam:Dynactin	489	768	8.2e-91	PFAM
low complexity region	800	820	N/A	INTRINSIC
coiled coil region	914	1009	N/A	INTRINSIC
low complexity region	1025	1043	N/A	INTRINSIC
coiled coil region	1143	1172	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000113907
AA Change: I818N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000109540
Gene: ENSMUSG00000031865
AA Change: I818N

Domain	Start	End	E-Value	Type
low complexity region	5	22	N/A	INTRINSIC
low complexity region	27	50	N/A	INTRINSIC
low complexity region	51	80	N/A	INTRINSIC
low complexity region	93	106	N/A	INTRINSIC
low complexity region	140	158	N/A	INTRINSIC
SCOP:d1lxa__	271	345	8e-3	SMART
Pfam:Dynactin	392	671	7.1e-91	PFAM
low complexity region	703	723	N/A	INTRINSIC
coiled coil region	817	912	N/A	INTRINSIC
low complexity region	928	946	N/A	INTRINSIC
coiled coil region	1046	1075	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000113913
AA Change: I935N

SMART Domains

Protein: ENSMUSP00000109546
Gene: ENSMUSG00000031865
AA Change: I935N

Domain	Start	End	E-Value	Type
CAP_GLY	12	78	5.52e-31	SMART
low complexity region	118	139	N/A	INTRINSIC
low complexity region	144	167	N/A	INTRINSIC
low complexity region	168	197	N/A	INTRINSIC
SCOP:d1fxkc_	205	357	3e-3	SMART
low complexity region	383	399	N/A	INTRINSIC
Pfam:Dynactin	509	788	2.5e-90	PFAM
low complexity region	820	840	N/A	INTRINSIC
coiled coil region	934	1029	N/A	INTRINSIC
low complexity region	1051	1069	N/A	INTRINSIC
coiled coil region	1168	1197	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113918
AA Change: I952N

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000109551
Gene: ENSMUSG00000031865
AA Change: I952N

Domain	Start	End	E-Value	Type
CAP_GLY	29	95	5.52e-31	SMART
low complexity region	135	156	N/A	INTRINSIC
low complexity region	161	184	N/A	INTRINSIC
low complexity region	185	214	N/A	INTRINSIC
low complexity region	227	240	N/A	INTRINSIC
low complexity region	274	292	N/A	INTRINSIC
low complexity region	400	416	N/A	INTRINSIC
Pfam:Dynactin	526	805	3.3e-90	PFAM
low complexity region	837	857	N/A	INTRINSIC
coiled coil region	951	1046	N/A	INTRINSIC
coiled coil region	1147	1176	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113919
AA Change: I952N

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000109552
Gene: ENSMUSG00000031865
AA Change: I952N

Domain	Start	End	E-Value	Type
CAP_GLY	29	95	5.52e-31	SMART
low complexity region	135	156	N/A	INTRINSIC
low complexity region	161	184	N/A	INTRINSIC
low complexity region	185	214	N/A	INTRINSIC
SCOP:d1fxkc_	222	374	3e-3	SMART
low complexity region	400	416	N/A	INTRINSIC
Pfam:Dynactin	522	805	1.4e-103	PFAM
low complexity region	837	857	N/A	INTRINSIC
coiled coil region	951	1046	N/A	INTRINSIC
low complexity region	1068	1086	N/A	INTRINSIC
coiled coil region	1185	1214	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127824

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130917

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153793

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154420

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.3%
20x: 89.0%

Validation Efficiency

MGI Phenotype

Strain: 3769512
Lethality: E8-E10
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the largest subunit of dynactin, a macromolecular complex consisting of 10 subunits ranging in size from 22 to 150 kD. Dynactin binds to both microtubules and cytoplasmic dynein. Dynactin is involved in a diverse array of cellular functions, including ER-to-Golgi transport, the centripetal movement of lysosomes and endosomes, spindle formation, chromosome movement, nuclear positioning, and axonogenesis. This subunit interacts with dynein intermediate chain by its domains directly binding to dynein and binds to microtubules via a highly conserved glycine-rich cytoskeleton-associated protein (CAP-Gly) domain in its N-terminus. Alternative splicing of this gene results in multiple transcript variants encoding distinct isoforms. Mutations in this gene cause distal hereditary motor neuronopathy type VIIB (HMN7B) which is also known as distal spinal and bulbar muscular atrophy (dSBMA). [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality and developmental arrest at E7.5 associated with increased apoptosis. [provided by MGI curators]

Allele List at MGI

All alleles(20) : Targeted(4) Gene trapped(16)

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg3	A	G	5: 104,936,014	M630T	probably benign	Het
Anpep	T	C	7: 79,842,011	I81V	probably benign	Het
Bub1	A	G	2: 127,809,013	S627P	probably benign	Het
C1s1	T	A	6: 124,537,480	N139I	probably damaging	Het
Car6	A	T	4: 150,192,578	V152D	probably damaging	Het
Cdh19	C	A	1: 110,919,645	M411I	probably benign	Het
Cep95	A	G	11: 106,809,705	E322G	probably damaging	Het
Chek1	C	A	9: 36,714,441	V303L	probably benign	Het
Dscaml1	T	C	9: 45,753,147	S2107P	probably damaging	Het
Dusp14	A	G	11: 84,048,771	I148T	probably damaging	Het
Eps15	A	G	4: 109,370,557	D645G	probably damaging	Het
Etl4	A	G	2: 20,801,579	N1153S	possibly damaging	Het
Fer1l6	A	G	15: 58,641,879	D1541G	probably benign	Het
Gm14496	A	G	2: 181,998,778	S513G	probably damaging	Het
H2-D1	G	T	17: 35,263,495	A64S	possibly damaging	Het
Hsd17b2	T	A	8: 117,702,170	F59I	possibly damaging	Het
Itgb7	T	G	15: 102,223,476	Q224P	probably damaging	Het
Jak1	A	G	4: 101,191,624		probably null	Het
Kdm1b	G	A	13: 47,064,231		probably null	Het
Lrp8	A	G	4: 107,854,416	I466V	probably damaging	Het
Mga	A	G	2: 119,964,562	D2909G	probably damaging	Het
Nol8	T	C	13: 49,661,504	S345P	probably benign	Het
Nup210l	T	C	3: 90,144,169	M540T	probably benign	Het
Obscn	C	T	11: 59,112,638	R1370H	probably benign	Het
Olfr1368	A	G	13: 21,142,955	F34S	probably damaging	Het
Pbx3	A	G	2: 34,175,953	V375A	probably benign	Het
Ppp1r9a	T	C	6: 4,906,168	V241A	possibly damaging	Het
Psmd6	C	T	14: 14,112,539	V354M	probably damaging	Het
Rab2a	T	C	4: 8,578,481	F94L	probably damaging	Het
Rev1	T	C	1: 38,055,490	D949G	probably damaging	Het
Ric8a	A	G	7: 140,858,178	D110G	probably damaging	Het
Rlf	A	T	4: 121,150,000	D594E	probably benign	Het
Sept1	C	A	7: 127,218,058		probably null	Het
Slco5a1	G	C	1: 12,990,383	P38R	probably damaging	Het
Snx33	C	A	9: 56,925,957	R276L	probably damaging	Het
Taf11	A	T	17: 27,905,279	D101E	probably benign	Het
Ttn	A	G	2: 76,934,220	S3168P	probably damaging	Het
Uggt2	T	C	14: 119,057,663	E41G	possibly damaging	Het
Vmn2r80	A	G	10: 79,194,415	R692G	probably damaging	Het
Zfp763	A	T	17: 33,021,784	W24R	probably damaging	Het

Other mutations in Dctn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01113:Dctn1	APN	6	83179897	missense	probably benign	0.00
IGL01450:Dctn1	APN	6	83194110	unclassified	probably benign
IGL01876:Dctn1	APN	6	83197921	missense	probably damaging	1.00
IGL01958:Dctn1	APN	6	83191344	missense	possibly damaging	0.95
IGL02554:Dctn1	APN	6	83182722	missense	probably damaging	1.00
IGL02668:Dctn1	APN	6	83191048	missense	possibly damaging	0.89
IGL02814:Dctn1	APN	6	83189914	missense	probably damaging	1.00
IGL02818:Dctn1	APN	6	83192514	missense	possibly damaging	0.86
IGL03007:Dctn1	APN	6	83182708	missense	probably damaging	1.00
IGL03065:Dctn1	APN	6	83192493	missense	probably damaging	0.99
IGL03083:Dctn1	APN	6	83197484	splice site	probably benign
IGL03394:Dctn1	APN	6	83191284	missense	possibly damaging	0.61
E0374:Dctn1	UTSW	6	83194174	missense	possibly damaging	0.93
IGL03014:Dctn1	UTSW	6	83197369	intron	probably benign
PIT4812001:Dctn1	UTSW	6	83199762	missense	possibly damaging	0.86
R0044:Dctn1	UTSW	6	83191134	missense	probably damaging	1.00
R0047:Dctn1	UTSW	6	83182632	nonsense	probably null
R0047:Dctn1	UTSW	6	83182632	nonsense	probably null
R0057:Dctn1	UTSW	6	83179892	missense	probably benign	0.14
R0731:Dctn1	UTSW	6	83183089	missense	probably damaging	0.98
R0738:Dctn1	UTSW	6	83190107	critical splice donor site	probably null
R0755:Dctn1	UTSW	6	83189077	missense	probably damaging	0.96
R0839:Dctn1	UTSW	6	83190477	missense	possibly damaging	0.53
R1035:Dctn1	UTSW	6	83190220	missense	probably damaging	1.00
R1454:Dctn1	UTSW	6	83197508	missense	possibly damaging	0.93
R1469:Dctn1	UTSW	6	83192889	missense	probably damaging	1.00
R1469:Dctn1	UTSW	6	83192889	missense	probably damaging	1.00
R1631:Dctn1	UTSW	6	83197596	missense	possibly damaging	0.56
R1812:Dctn1	UTSW	6	83192518	missense	possibly damaging	0.85
R1928:Dctn1	UTSW	6	83199184	splice site	probably benign
R2008:Dctn1	UTSW	6	83189956	missense	probably damaging	0.99
R2242:Dctn1	UTSW	6	83199705	missense	probably damaging	0.99
R2259:Dctn1	UTSW	6	83197586	missense	possibly damaging	0.46
R2422:Dctn1	UTSW	6	83199800	missense	possibly damaging	0.92
R2483:Dctn1	UTSW	6	83194187	missense	probably damaging	1.00
R4455:Dctn1	UTSW	6	83195049	missense	probably damaging	1.00
R4724:Dctn1	UTSW	6	83189938	missense	possibly damaging	0.53
R4812:Dctn1	UTSW	6	83189937	missense	probably benign	0.24
R4819:Dctn1	UTSW	6	83190519	missense	probably damaging	0.97
R4831:Dctn1	UTSW	6	83199771	missense	possibly damaging	0.46
R4928:Dctn1	UTSW	6	83189207	missense	possibly damaging	0.73
R5087:Dctn1	UTSW	6	83191639	missense	probably damaging	1.00
R5354:Dctn1	UTSW	6	83183126	missense	possibly damaging	0.93
R5372:Dctn1	UTSW	6	83190210	missense	probably damaging	0.96
R5493:Dctn1	UTSW	6	83182564	missense	possibly damaging	0.89
R5494:Dctn1	UTSW	6	83182564	missense	possibly damaging	0.89
R5732:Dctn1	UTSW	6	83197949	critical splice donor site	probably null
R5856:Dctn1	UTSW	6	83197865	missense	probably damaging	1.00
R6025:Dctn1	UTSW	6	83193691	intron	probably null
R6999:Dctn1	UTSW	6	83191281	missense	possibly damaging	0.89
R7052:Dctn1	UTSW	6	83195280	intron	probably null
R7133:Dctn1	UTSW	6	83180044	intron	probably null
R7485:Dctn1	UTSW	6	83189905	missense	possibly damaging	0.85
R7607:Dctn1	UTSW	6	83195069	nonsense	probably null
R7729:Dctn1	UTSW	6	83183060	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTGACTGGAGCAGTCTCTTTCCC -3'
(R):5'- CAGTTCCTGAACGTCACCGTCATC -3'

Sequencing Primer
(F):5'- AGTCTCTTTCCCCCGCC -3'
(R):5'- gtgttcctggtgccctc -3'

Posted On

2014-04-24