Incidental Mutation 'R1627:Kdm1b'
ID172570
Institutional Source Beutler Lab
Gene Symbol Kdm1b
Ensembl Gene ENSMUSG00000038080
Gene Namelysine (K)-specific demethylase 1B
Synonyms4632428N09Rik, Aof1
MMRRC Submission 039664-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.543) question?
Stock #R1627 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location47043499-47085279 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 47064231 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000037025]
Predicted Effect probably null
Transcript: ENSMUST00000037025
SMART Domains Protein: ENSMUSP00000038373
Gene: ENSMUSG00000038080

DomainStartEndE-ValueType
Pfam:zf-CW 138 191 2.6e-13 PFAM
low complexity region 235 253 N/A INTRINSIC
Pfam:SWIRM 286 369 6e-12 PFAM
Pfam:Pyr_redox_2 368 490 3.1e-8 PFAM
Pfam:Thi4 375 446 2.2e-10 PFAM
Pfam:FAD_binding_3 388 423 4.1e-7 PFAM
Pfam:HI0933_like 389 428 1.6e-7 PFAM
Pfam:FAD_binding_2 390 428 1.6e-6 PFAM
Pfam:Pyr_redox 390 438 8e-8 PFAM
Pfam:NAD_binding_8 393 460 1.6e-13 PFAM
Pfam:Amino_oxidase 398 824 3.7e-86 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131120
Predicted Effect probably null
Transcript: ENSMUST00000143518
SMART Domains Protein: ENSMUSP00000114999
Gene: ENSMUSG00000038080

DomainStartEndE-ValueType
Pfam:SWIRM 3 86 1.1e-12 PFAM
Pfam:Thi4 91 163 3.5e-10 PFAM
Pfam:FAD_binding_3 105 140 3.5e-7 PFAM
Pfam:HI0933_like 106 145 1.7e-7 PFAM
Pfam:Pyr_redox_2 106 251 1.5e-10 PFAM
Pfam:FAD_binding_2 107 150 5.7e-7 PFAM
Pfam:Pyr_redox 107 158 6.4e-8 PFAM
Pfam:Pyr_redox_3 109 288 1.2e-13 PFAM
Pfam:NAD_binding_8 110 177 2.3e-13 PFAM
Pfam:Amino_oxidase 115 181 8.6e-19 PFAM
Pfam:Amino_oxidase 178 441 4.5e-63 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice of both sexes are viable, grossly normal and male mice are fertile; however, heterozygous progeny of homozygous null mothers display severe placental defects, embryonic growth impairment, neural tube defects and pericardial edema, and do not survive past E10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 A G 5: 104,936,014 M630T probably benign Het
Anpep T C 7: 79,842,011 I81V probably benign Het
Bub1 A G 2: 127,809,013 S627P probably benign Het
C1s1 T A 6: 124,537,480 N139I probably damaging Het
Car6 A T 4: 150,192,578 V152D probably damaging Het
Cdh19 C A 1: 110,919,645 M411I probably benign Het
Cep95 A G 11: 106,809,705 E322G probably damaging Het
Chek1 C A 9: 36,714,441 V303L probably benign Het
Dctn1 T A 6: 83,195,082 I818N probably damaging Het
Dscaml1 T C 9: 45,753,147 S2107P probably damaging Het
Dusp14 A G 11: 84,048,771 I148T probably damaging Het
Eps15 A G 4: 109,370,557 D645G probably damaging Het
Etl4 A G 2: 20,801,579 N1153S possibly damaging Het
Fer1l6 A G 15: 58,641,879 D1541G probably benign Het
Gm14496 A G 2: 181,998,778 S513G probably damaging Het
H2-D1 G T 17: 35,263,495 A64S possibly damaging Het
Hsd17b2 T A 8: 117,702,170 F59I possibly damaging Het
Itgb7 T G 15: 102,223,476 Q224P probably damaging Het
Jak1 A G 4: 101,191,624 probably null Het
Lrp8 A G 4: 107,854,416 I466V probably damaging Het
Mga A G 2: 119,964,562 D2909G probably damaging Het
Nol8 T C 13: 49,661,504 S345P probably benign Het
Nup210l T C 3: 90,144,169 M540T probably benign Het
Obscn C T 11: 59,112,638 R1370H probably benign Het
Olfr1368 A G 13: 21,142,955 F34S probably damaging Het
Pbx3 A G 2: 34,175,953 V375A probably benign Het
Ppp1r9a T C 6: 4,906,168 V241A possibly damaging Het
Psmd6 C T 14: 14,112,539 V354M probably damaging Het
Rab2a T C 4: 8,578,481 F94L probably damaging Het
Rev1 T C 1: 38,055,490 D949G probably damaging Het
Ric8a A G 7: 140,858,178 D110G probably damaging Het
Rlf A T 4: 121,150,000 D594E probably benign Het
Sept1 C A 7: 127,218,058 probably null Het
Slco5a1 G C 1: 12,990,383 P38R probably damaging Het
Snx33 C A 9: 56,925,957 R276L probably damaging Het
Taf11 A T 17: 27,905,279 D101E probably benign Het
Ttn A G 2: 76,934,220 S3168P probably damaging Het
Uggt2 T C 14: 119,057,663 E41G possibly damaging Het
Vmn2r80 A G 10: 79,194,415 R692G probably damaging Het
Zfp763 A T 17: 33,021,784 W24R probably damaging Het
Other mutations in Kdm1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Kdm1b APN 13 47068540 missense probably benign 0.01
IGL00924:Kdm1b APN 13 47068480 missense probably benign
IGL01553:Kdm1b APN 13 47080548 missense probably damaging 0.96
IGL01663:Kdm1b APN 13 47073737 missense probably damaging 0.99
IGL02385:Kdm1b APN 13 47068506 missense possibly damaging 0.49
IGL02505:Kdm1b APN 13 47060855 missense probably damaging 1.00
IGL02826:Kdm1b APN 13 47080467 missense probably damaging 1.00
IGL03257:Kdm1b APN 13 47049266 missense probably damaging 1.00
R0052:Kdm1b UTSW 13 47064117 missense probably damaging 1.00
R0319:Kdm1b UTSW 13 47053719 missense probably benign
R0426:Kdm1b UTSW 13 47064244 splice site probably benign
R0599:Kdm1b UTSW 13 47058810 missense possibly damaging 0.47
R0764:Kdm1b UTSW 13 47068603 missense possibly damaging 0.70
R1163:Kdm1b UTSW 13 47071922 missense probably benign 0.02
R1543:Kdm1b UTSW 13 47068521 missense probably damaging 0.99
R1584:Kdm1b UTSW 13 47064054 missense probably damaging 1.00
R1669:Kdm1b UTSW 13 47068548 missense probably damaging 1.00
R1758:Kdm1b UTSW 13 47060768 missense probably benign 0.00
R1860:Kdm1b UTSW 13 47049190 missense probably benign 0.03
R1907:Kdm1b UTSW 13 47064120 missense probably benign 0.00
R2225:Kdm1b UTSW 13 47064088 frame shift probably null
R2239:Kdm1b UTSW 13 47073755 missense probably damaging 1.00
R2271:Kdm1b UTSW 13 47064088 frame shift probably null
R2302:Kdm1b UTSW 13 47064088 frame shift probably null
R2303:Kdm1b UTSW 13 47064088 frame shift probably null
R2380:Kdm1b UTSW 13 47073755 missense probably damaging 1.00
R2442:Kdm1b UTSW 13 47062975 missense probably benign 0.32
R3022:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R3054:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R3545:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R3546:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R3548:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4094:Kdm1b UTSW 13 47063020 missense probably damaging 1.00
R4419:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4420:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4502:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4547:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4548:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4785:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4793:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4804:Kdm1b UTSW 13 47063077 missense probably damaging 1.00
R4882:Kdm1b UTSW 13 47060893 missense probably benign
R4906:Kdm1b UTSW 13 47063144 critical splice donor site probably null
R4965:Kdm1b UTSW 13 47074367 missense probably damaging 0.98
R5039:Kdm1b UTSW 13 47077486 missense probably damaging 1.00
R5098:Kdm1b UTSW 13 47062991 missense probably damaging 1.00
R5265:Kdm1b UTSW 13 47062969 missense probably benign 0.35
R5541:Kdm1b UTSW 13 47079196 missense probably damaging 1.00
R5814:Kdm1b UTSW 13 47063146 splice site probably null
R6046:Kdm1b UTSW 13 47079253 missense possibly damaging 0.92
R6798:Kdm1b UTSW 13 47068536 missense probably benign 0.00
R6903:Kdm1b UTSW 13 47074404 missense probably benign 0.00
R7831:Kdm1b UTSW 13 47050622 missense probably benign 0.17
R7973:Kdm1b UTSW 13 47077446 missense probably benign 0.00
R8181:Kdm1b UTSW 13 47051901 critical splice donor site probably null
R8248:Kdm1b UTSW 13 47071878 intron probably benign
Predicted Primers PCR Primer
(F):5'- TGTGAACACAGGAAGCTCTCACCC -3'
(R):5'- GCAGAGTCTCACCTTCATCCCAAAG -3'

Sequencing Primer
(F):5'- GCTCTCACCCCTCAGAAGTG -3'
(R):5'- CTGGAAGGTTCTAACTGCTAAGC -3'
Posted On2014-04-24