Incidental Mutation 'R1627:Psmd6'
ID172572
Institutional Source Beutler Lab
Gene Symbol Psmd6
Ensembl Gene ENSMUSG00000021737
Gene Nameproteasome (prosome, macropain) 26S subunit, non-ATPase, 6
Synonyms
MMRRC Submission 039664-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R1627 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location14112174-14120984 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 14112539 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 354 (V354M)
Ref Sequence ENSEMBL: ENSMUSP00000022256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022256] [ENSMUST00000224955]
Predicted Effect probably damaging
Transcript: ENSMUST00000022256
AA Change: V354M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022256
Gene: ENSMUSG00000021737
AA Change: V354M

DomainStartEndE-ValueType
Pfam:RPN7 66 239 5e-65 PFAM
PINT 290 373 9.59e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127228
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153237
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224076
Predicted Effect probably benign
Transcript: ENSMUST00000224955
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the protease subunit S10 family. The encoded protein is a subunit of the 26S proteasome which colocalizes with DNA damage foci and is involved in the ATP-dependent degradation of ubiquinated proteins. Alternative splicing results in multiple transcript variants [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 A G 5: 104,936,014 M630T probably benign Het
Anpep T C 7: 79,842,011 I81V probably benign Het
Bub1 A G 2: 127,809,013 S627P probably benign Het
C1s1 T A 6: 124,537,480 N139I probably damaging Het
Car6 A T 4: 150,192,578 V152D probably damaging Het
Cdh19 C A 1: 110,919,645 M411I probably benign Het
Cep95 A G 11: 106,809,705 E322G probably damaging Het
Chek1 C A 9: 36,714,441 V303L probably benign Het
Dctn1 T A 6: 83,195,082 I818N probably damaging Het
Dscaml1 T C 9: 45,753,147 S2107P probably damaging Het
Dusp14 A G 11: 84,048,771 I148T probably damaging Het
Eps15 A G 4: 109,370,557 D645G probably damaging Het
Etl4 A G 2: 20,801,579 N1153S possibly damaging Het
Fer1l6 A G 15: 58,641,879 D1541G probably benign Het
Gm14496 A G 2: 181,998,778 S513G probably damaging Het
H2-D1 G T 17: 35,263,495 A64S possibly damaging Het
Hsd17b2 T A 8: 117,702,170 F59I possibly damaging Het
Itgb7 T G 15: 102,223,476 Q224P probably damaging Het
Jak1 A G 4: 101,191,624 probably null Het
Kdm1b G A 13: 47,064,231 probably null Het
Lrp8 A G 4: 107,854,416 I466V probably damaging Het
Mga A G 2: 119,964,562 D2909G probably damaging Het
Nol8 T C 13: 49,661,504 S345P probably benign Het
Nup210l T C 3: 90,144,169 M540T probably benign Het
Obscn C T 11: 59,112,638 R1370H probably benign Het
Olfr1368 A G 13: 21,142,955 F34S probably damaging Het
Pbx3 A G 2: 34,175,953 V375A probably benign Het
Ppp1r9a T C 6: 4,906,168 V241A possibly damaging Het
Rab2a T C 4: 8,578,481 F94L probably damaging Het
Rev1 T C 1: 38,055,490 D949G probably damaging Het
Ric8a A G 7: 140,858,178 D110G probably damaging Het
Rlf A T 4: 121,150,000 D594E probably benign Het
Sept1 C A 7: 127,218,058 probably null Het
Slco5a1 G C 1: 12,990,383 P38R probably damaging Het
Snx33 C A 9: 56,925,957 R276L probably damaging Het
Taf11 A T 17: 27,905,279 D101E probably benign Het
Ttn A G 2: 76,934,220 S3168P probably damaging Het
Uggt2 T C 14: 119,057,663 E41G possibly damaging Het
Vmn2r80 A G 10: 79,194,415 R692G probably damaging Het
Zfp763 A T 17: 33,021,784 W24R probably damaging Het
Other mutations in Psmd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01512:Psmd6 APN 14 14114237 missense probably damaging 1.00
IGL01937:Psmd6 APN 14 14116169 missense probably benign 0.00
IGL03240:Psmd6 APN 14 14112393 unclassified probably benign
IGL03284:Psmd6 APN 14 14112546 missense probably benign 0.00
R1479:Psmd6 UTSW 14 14116819 intron probably benign
R1942:Psmd6 UTSW 14 14116442 missense probably damaging 1.00
R4151:Psmd6 UTSW 14 14120157 missense probably benign 0.02
R4279:Psmd6 UTSW 14 14112297 missense possibly damaging 0.81
R4776:Psmd6 UTSW 14 14120932 unclassified probably benign
R4799:Psmd6 UTSW 14 14120126 missense probably benign
R4956:Psmd6 UTSW 14 14116166 missense probably benign 0.16
R5599:Psmd6 UTSW 14 14120144 missense probably benign 0.01
R5828:Psmd6 UTSW 14 14119990 missense probably benign 0.16
R5884:Psmd6 UTSW 14 14116526 missense probably damaging 1.00
R6362:Psmd6 UTSW 14 14116949 missense probably benign 0.07
R7208:Psmd6 UTSW 14 14112225 utr 3 prime probably null
R7590:Psmd6 UTSW 14 14119882 frame shift probably null
R7677:Psmd6 UTSW 14 14120837 missense probably benign 0.19
R7773:Psmd6 UTSW 14 14119882 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGATGCTGTTGAAGTGGGCACAC -3'
(R):5'- AGCCGTTGCTTTTCCAGTTCAGG -3'

Sequencing Primer
(F):5'- TGAACCCTGTTTAGCAGCAAG -3'
(R):5'- ATAACTTCTAGGGCCAGGTTTC -3'
Posted On2014-04-24