Mutagenetix > Incidental Mutations

Incidental Mutation 'R1627:Uggt2'

172574

Institutional Source

Beutler Lab

Gene Symbol

Uggt2

Ensembl Gene

ENSMUSG00000042104

Gene Name

UDP-glucose glycoprotein glucosyltransferase 2

Synonyms

3110001A05Rik, 3110027P15Rik, 1810064L21Rik, Ugcgl2, A230065J02Rik

MMRRC Submission

039664-MU

Accession Numbers

NCBI RefSeq: NM_001081252.2; MGI:1913685

Is this an essential gene?

Probably non essential (E-score: 0.144) question?

Stock #

R1627 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

118985039-119099430 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 119057663 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 41 (E41G)

Ref Sequence

ENSEMBL: ENSMUSP00000117738 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000127153] [ENSMUST00000156203]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000127153
AA Change: E41G

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000117738
Gene: ENSMUSG00000042104
AA Change: E41G

Domain	Start	End	E-Value	Type
low complexity region	327	334	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136924

Predicted Effect

possibly damaging
Transcript: ENSMUST00000156203
AA Change: E517G

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000121249
Gene: ENSMUSG00000042104
AA Change: E517G

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:UDP-g_GGTase	23	1189	N/A	PFAM
SCOP:d1ga8a_	1219	1485	9e-44	SMART
Blast:BROMO	1377	1427	4e-16	BLAST

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.3%
20x: 89.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UDP-glucose:glycoprotein glucosyltransferase (UGT) is a soluble protein of the endoplasmic reticulum (ER) that selectively reglucosylates unfolded glycoproteins, thus providing quality control for protein transport out of the ER.[supplied by OMIM, Oct 2009]

Allele List at MGI

All alleles(5) : Targeted(2) Gene trapped(3)

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg3	A	G	5: 104,936,014	M630T	probably benign	Het
Anpep	T	C	7: 79,842,011	I81V	probably benign	Het
Bub1	A	G	2: 127,809,013	S627P	probably benign	Het
C1s1	T	A	6: 124,537,480	N139I	probably damaging	Het
Car6	A	T	4: 150,192,578	V152D	probably damaging	Het
Cdh19	C	A	1: 110,919,645	M411I	probably benign	Het
Cep95	A	G	11: 106,809,705	E322G	probably damaging	Het
Chek1	C	A	9: 36,714,441	V303L	probably benign	Het
Dctn1	T	A	6: 83,195,082	I818N	probably damaging	Het
Dscaml1	T	C	9: 45,753,147	S2107P	probably damaging	Het
Dusp14	A	G	11: 84,048,771	I148T	probably damaging	Het
Eps15	A	G	4: 109,370,557	D645G	probably damaging	Het
Etl4	A	G	2: 20,801,579	N1153S	possibly damaging	Het
Fer1l6	A	G	15: 58,641,879	D1541G	probably benign	Het
Gm14496	A	G	2: 181,998,778	S513G	probably damaging	Het
H2-D1	G	T	17: 35,263,495	A64S	possibly damaging	Het
Hsd17b2	T	A	8: 117,702,170	F59I	possibly damaging	Het
Itgb7	T	G	15: 102,223,476	Q224P	probably damaging	Het
Jak1	A	G	4: 101,191,624		probably null	Het
Kdm1b	G	A	13: 47,064,231		probably null	Het
Lrp8	A	G	4: 107,854,416	I466V	probably damaging	Het
Mga	A	G	2: 119,964,562	D2909G	probably damaging	Het
Nol8	T	C	13: 49,661,504	S345P	probably benign	Het
Nup210l	T	C	3: 90,144,169	M540T	probably benign	Het
Obscn	C	T	11: 59,112,638	R1370H	probably benign	Het
Olfr1368	A	G	13: 21,142,955	F34S	probably damaging	Het
Pbx3	A	G	2: 34,175,953	V375A	probably benign	Het
Ppp1r9a	T	C	6: 4,906,168	V241A	possibly damaging	Het
Psmd6	C	T	14: 14,112,539	V354M	probably damaging	Het
Rab2a	T	C	4: 8,578,481	F94L	probably damaging	Het
Rev1	T	C	1: 38,055,490	D949G	probably damaging	Het
Ric8a	A	G	7: 140,858,178	D110G	probably damaging	Het
Rlf	A	T	4: 121,150,000	D594E	probably benign	Het
Sept1	C	A	7: 127,218,058		probably null	Het
Slco5a1	G	C	1: 12,990,383	P38R	probably damaging	Het
Snx33	C	A	9: 56,925,957	R276L	probably damaging	Het
Taf11	A	T	17: 27,905,279	D101E	probably benign	Het
Ttn	A	G	2: 76,934,220	S3168P	probably damaging	Het
Vmn2r80	A	G	10: 79,194,415	R692G	probably damaging	Het
Zfp763	A	T	17: 33,021,784	W24R	probably damaging	Het

Other mutations in Uggt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00158:Uggt2	APN	14	119049276	missense	possibly damaging	0.94
IGL00430:Uggt2	APN	14	119026429	nonsense	probably null
IGL00433:Uggt2	APN	14	119013487	missense	probably benign
IGL00572:Uggt2	APN	14	119042791	missense	probably benign	0.02
IGL00577:Uggt2	APN	14	119034900	missense	possibly damaging	0.89
IGL00671:Uggt2	APN	14	119042799	missense	possibly damaging	0.73
IGL01482:Uggt2	APN	14	119057645	missense	probably damaging	1.00
IGL01630:Uggt2	APN	14	119042772	missense	probably benign	0.00
IGL01787:Uggt2	APN	14	119081734	missense	probably damaging	0.99
IGL02063:Uggt2	APN	14	119089193	missense	possibly damaging	0.79
IGL02809:Uggt2	APN	14	119090738	missense	probably benign	0.17
IGL02894:Uggt2	APN	14	119081799	missense	probably damaging	0.96
IGL03062:Uggt2	APN	14	119075346	missense	probably damaging	1.00
IGL03139:Uggt2	APN	14	119095310	missense	probably benign	0.25
IGL03142:Uggt2	APN	14	118998191	missense	probably damaging	1.00
IGL03168:Uggt2	APN	14	119077668	missense	probably damaging	0.98
IGL03348:Uggt2	APN	14	119070888	missense	probably benign	0.38
P0014:Uggt2	UTSW	14	119044538	missense	probably damaging	1.00
R0006:Uggt2	UTSW	14	119049663	missense	probably benign	0.07
R0063:Uggt2	UTSW	14	119007130	splice site	probably benign
R0063:Uggt2	UTSW	14	119007130	splice site	probably benign
R0383:Uggt2	UTSW	14	119049451	missense	probably damaging	1.00
R0433:Uggt2	UTSW	14	119075329	critical splice donor site	probably null
R0472:Uggt2	UTSW	14	119095336	missense	probably damaging	1.00
R0609:Uggt2	UTSW	14	119095336	missense	probably damaging	1.00
R0645:Uggt2	UTSW	14	119057598	missense	probably benign	0.27
R0788:Uggt2	UTSW	14	119095400	splice site	probably benign
R0940:Uggt2	UTSW	14	119091192	critical splice donor site	probably null
R1567:Uggt2	UTSW	14	119009093	missense	possibly damaging	0.58
R1682:Uggt2	UTSW	14	119054643	missense	probably benign	0.19
R1746:Uggt2	UTSW	14	119013503	missense	probably benign	0.00
R1785:Uggt2	UTSW	14	119061376	missense	probably damaging	1.00
R1786:Uggt2	UTSW	14	119061376	missense	probably damaging	1.00
R1799:Uggt2	UTSW	14	119032276	missense	probably benign	0.00
R1894:Uggt2	UTSW	14	119049718	missense	probably damaging	0.99
R1918:Uggt2	UTSW	14	119008055	splice site	probably benign
R2149:Uggt2	UTSW	14	119075345	missense	probably benign	0.02
R2168:Uggt2	UTSW	14	119019505	missense	probably damaging	1.00
R2219:Uggt2	UTSW	14	119075337	missense	probably damaging	1.00
R2220:Uggt2	UTSW	14	119075337	missense	probably damaging	1.00
R2240:Uggt2	UTSW	14	118995049	missense	probably damaging	1.00
R2331:Uggt2	UTSW	14	119026599	missense	possibly damaging	0.87
R2904:Uggt2	UTSW	14	119059109	missense	possibly damaging	0.74
R2906:Uggt2	UTSW	14	119019507	missense	probably benign	0.00
R2907:Uggt2	UTSW	14	119019507	missense	probably benign	0.00
R2908:Uggt2	UTSW	14	119019507	missense	probably benign	0.00
R2998:Uggt2	UTSW	14	119049385	missense	probably damaging	1.00
R3407:Uggt2	UTSW	14	119091270	missense	probably benign	0.39
R3722:Uggt2	UTSW	14	119041518	missense	probably damaging	1.00
R3749:Uggt2	UTSW	14	119057672	missense	probably benign	0.13
R4015:Uggt2	UTSW	14	119026433	missense	possibly damaging	0.47
R4016:Uggt2	UTSW	14	119026433	missense	possibly damaging	0.47
R4017:Uggt2	UTSW	14	119026433	missense	possibly damaging	0.47
R4206:Uggt2	UTSW	14	119049262	missense	probably damaging	1.00
R4536:Uggt2	UTSW	14	119019558	missense	probably benign
R4642:Uggt2	UTSW	14	119034935	missense	probably benign	0.00
R4654:Uggt2	UTSW	14	119032258	missense	possibly damaging	0.46
R4770:Uggt2	UTSW	14	119029054	splice site	probably null
R4810:Uggt2	UTSW	14	119013521	missense	probably damaging	1.00
R4832:Uggt2	UTSW	14	119001847	missense	probably damaging	0.99
R4856:Uggt2	UTSW	14	119035964	splice site	probably null
R4886:Uggt2	UTSW	14	119035964	splice site	probably null
R4888:Uggt2	UTSW	14	119049253	missense	probably damaging	1.00
R4888:Uggt2	UTSW	14	119077650	critical splice donor site	probably null
R4895:Uggt2	UTSW	14	119018886	missense	probably damaging	1.00
R5353:Uggt2	UTSW	14	119081770	missense	probably benign	0.00
R5423:Uggt2	UTSW	14	119019486	missense	probably damaging	1.00
R5476:Uggt2	UTSW	14	119090709	missense	probably benign	0.01
R5561:Uggt2	UTSW	14	119041527	missense	probably benign	0.02
R5607:Uggt2	UTSW	14	119089199	missense	possibly damaging	0.81
R5608:Uggt2	UTSW	14	119089199	missense	possibly damaging	0.81
R5625:Uggt2	UTSW	14	119077724	missense	probably damaging	1.00
R5698:Uggt2	UTSW	14	119042726	missense	probably damaging	1.00
R5986:Uggt2	UTSW	14	119049426	missense	probably damaging	1.00
R6031:Uggt2	UTSW	14	119070826	missense	probably benign	0.06
R6031:Uggt2	UTSW	14	119070826	missense	probably benign	0.06
R6056:Uggt2	UTSW	14	119035969	critical splice donor site	probably null
R6289:Uggt2	UTSW	14	119041602	missense	probably damaging	0.99
R6480:Uggt2	UTSW	14	119057564	missense	probably benign	0.01
R6515:Uggt2	UTSW	14	119077719	missense	possibly damaging	0.89
R6706:Uggt2	UTSW	14	119070881	missense	probably damaging	1.00
R6745:Uggt2	UTSW	14	119042610	missense	possibly damaging	0.58
R6819:Uggt2	UTSW	14	119026435	missense	probably damaging	1.00
R6879:Uggt2	UTSW	14	119001859	missense	probably benign	0.10
R7117:Uggt2	UTSW	14	119014526	missense	probably benign	0.25
R7183:Uggt2	UTSW	14	119019637	splice site	probably null
R7337:Uggt2	UTSW	14	119086175	missense	probably benign	0.28
R7342:Uggt2	UTSW	14	118994972	missense	possibly damaging	0.56
R7615:Uggt2	UTSW	14	119089269	missense	probably benign	0.12
R7625:Uggt2	UTSW	14	119026493	missense	probably damaging	1.00
R7685:Uggt2	UTSW	14	119075347	missense	probably damaging	1.00
R7842:Uggt2	UTSW	14	118998104	missense	probably damaging	1.00
R7891:Uggt2	UTSW	14	119042647	missense	probably benign	0.09
R7938:Uggt2	UTSW	14	119059107	missense	possibly damaging	0.68
R8050:Uggt2	UTSW	14	119026422	missense	probably damaging	0.98
Z1177:Uggt2	UTSW	14	119007296	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTGTCGTTCATCATTGCATTGCATC -3'
(R):5'- ACTCTGGAAGTATCTTAGGGCCACTTG -3'

Sequencing Primer
(F):5'- tgcctgcttataatactgggac -3'
(R):5'- CAGTTTGCAGGACTGTCATAGC -3'

Posted On

2014-04-24