Incidental Mutation 'R1628:Camk1d'
ID172584
Institutional Source Beutler Lab
Gene Symbol Camk1d
Ensembl Gene ENSMUSG00000039145
Gene Namecalcium/calmodulin-dependent protein kinase ID
SynonymsE030025C11Rik, CaMKIdelta, CKLiK, A630059D12Rik
MMRRC Submission 039665-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1628 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location5293457-5714515 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5311037 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 263 (D263G)
Ref Sequence ENSEMBL: ENSMUSP00000037028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044009] [ENSMUST00000114987]
Predicted Effect probably damaging
Transcript: ENSMUST00000044009
AA Change: D263G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000037028
Gene: ENSMUSG00000039145
AA Change: D263G

DomainStartEndE-ValueType
S_TKc 23 279 5.87e-112 SMART
low complexity region 326 343 N/A INTRINSIC
low complexity region 358 368 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114987
AA Change: D255G

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110638
Gene: ENSMUSG00000039145
AA Change: D255G

DomainStartEndE-ValueType
S_TKc 23 271 1.35e-102 SMART
low complexity region 318 335 N/A INTRINSIC
low complexity region 350 360 N/A INTRINSIC
Meta Mutation Damage Score 0.8971 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the calcium/calmodulin-dependent protein kinase 1 family, a subfamily of the serine/threonine kinases. The encoded protein is a component of the calcium-regulated calmodulin-dependent protein kinase cascade. It has been associated with multiple processes including regulation of granulocyte function, activation of CREB-dependent gene transcription, aldosterone synthesis, differentiation and activation of neutrophil cells, and apoptosis of erythroleukemia cells. Alternatively spliced transcript variants encoding different isoforms of this gene have been described. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 C T 17: 84,691,991 Q172* probably null Het
AI467606 G A 7: 127,092,583 G110D probably benign Het
Arhgef15 A C 11: 68,944,814 L805R possibly damaging Het
B3galnt1 G A 3: 69,575,628 T100I probably damaging Het
Bod1l T A 5: 41,816,982 M2330L probably benign Het
Calcr A T 6: 3,700,251 H280Q possibly damaging Het
Cd48 T A 1: 171,704,852 I233N probably damaging Het
Cyp3a25 A T 5: 146,001,463 Y68* probably null Het
Dapk3 C A 10: 81,191,809 T227K possibly damaging Het
Dnajc22 A G 15: 99,100,936 M1V probably null Het
Etv5 C T 16: 22,401,671 probably null Het
Gabrr1 A G 4: 33,152,432 Y124C probably damaging Het
Gba2 C T 4: 43,570,118 R392Q probably benign Het
Gli3 C G 13: 15,726,312 A1428G probably benign Het
Gls G A 1: 52,232,676 A106V probably benign Het
Gm1966 A T 7: 106,603,269 L256* probably null Het
Gm21370 A G 13: 120,026,878 V45A possibly damaging Het
Gm8765 T C 13: 50,702,288 L654P probably benign Het
Gpr4 A G 7: 19,223,199 T349A probably benign Het
Gpr6 C T 10: 41,071,548 V13M possibly damaging Het
Hectd3 A G 4: 116,997,392 H345R probably damaging Het
Igfl3 A T 7: 18,180,307 K135N probably benign Het
Il23r A G 6: 67,423,609 L579S probably damaging Het
Itsn2 A C 12: 4,629,652 M154L probably benign Het
Junb T A 8: 84,978,410 Q7L possibly damaging Het
Kif21b T A 1: 136,171,220 H1415Q probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klhdc10 T G 6: 30,444,462 F79L probably damaging Het
Klk1b8 A G 7: 43,954,141 probably null Het
Lmbrd2 T A 15: 9,182,506 N509K probably damaging Het
Mctp2 A G 7: 72,211,589 probably null Het
Myo3b A G 2: 70,286,962 N913S probably benign Het
N4bp2 G A 5: 65,803,572 probably null Het
Nt5c1a A G 4: 123,208,491 E70G possibly damaging Het
Olfr358 A G 2: 37,004,726 V296A probably damaging Het
Papln A G 12: 83,784,406 probably benign Het
Pcnx3 G T 19: 5,686,065 S244R probably damaging Het
Pecam1 A T 11: 106,682,960 probably null Het
Plppr4 A T 3: 117,328,272 L219Q probably damaging Het
Ppp2r5b A G 19: 6,230,905 probably null Het
Ralgapb A G 2: 158,430,463 R146G probably benign Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Rfpl4b T G 10: 38,821,534 I24L probably benign Het
Serpinb1b G A 13: 33,093,654 C290Y probably benign Het
Slc25a17 A G 15: 81,360,724 S3P possibly damaging Het
Slc4a11 A C 2: 130,687,127 probably null Het
Sptb A G 12: 76,583,848 Y2231H probably damaging Het
Srgap1 T G 10: 121,870,339 M221L probably benign Het
Srgap3 A G 6: 112,739,370 L599P probably damaging Het
Svep1 C T 4: 58,107,561 V1177M probably benign Het
Tarbp1 A G 8: 126,430,860 F1303L possibly damaging Het
Tbxa2r T C 10: 81,334,507 S276P possibly damaging Het
Try10 A T 6: 41,357,456 D194V probably damaging Het
Ttc37 A G 13: 76,111,791 E70G possibly damaging Het
Ttc39c T C 18: 12,734,879 probably benign Het
Ttc8 G A 12: 98,982,521 V489M probably benign Het
Unc13b G T 4: 43,263,371 R1912L probably damaging Het
Unc45b T A 11: 82,929,380 probably null Het
Usp17lb T C 7: 104,840,841 Y292C probably damaging Het
Usp34 A G 11: 23,488,725 D3429G probably damaging Het
Usp42 A G 5: 143,717,367 S500P probably damaging Het
Vmn2r14 T C 5: 109,219,972 M385V probably benign Het
Vmn2r60 G A 7: 42,136,406 W211* probably null Het
Vwf A T 6: 125,647,738 probably benign Het
Wdfy4 A T 14: 32,959,961 F3018I probably damaging Het
Wwox A G 8: 114,448,233 T102A probably benign Het
Zfp142 A C 1: 74,571,888 L813R possibly damaging Het
Zfp407 G A 18: 84,354,533 T1670M probably damaging Het
Zfp93 A G 7: 24,274,857 E89G probably benign Het
Zwint C T 10: 72,656,295 Q18* probably null Het
Other mutations in Camk1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00827:Camk1d APN 2 5311073 splice site probably benign
IGL02138:Camk1d APN 2 5445084 nonsense probably null
IGL02826:Camk1d APN 2 5565760 missense possibly damaging 0.56
IGL02999:Camk1d APN 2 5354705 missense probably benign 0.44
R0432:Camk1d UTSW 2 5445135 missense probably damaging 1.00
R1180:Camk1d UTSW 2 5362025 nonsense probably null
R1448:Camk1d UTSW 2 5362025 nonsense probably null
R1850:Camk1d UTSW 2 5362015 missense probably benign 0.08
R1998:Camk1d UTSW 2 5362025 nonsense probably null
R2000:Camk1d UTSW 2 5362025 nonsense probably null
R2513:Camk1d UTSW 2 5714236 start codon destroyed probably null 0.15
R4065:Camk1d UTSW 2 5565773 missense probably damaging 1.00
R4201:Camk1d UTSW 2 5354776 missense probably benign 0.03
R4581:Camk1d UTSW 2 5354704 missense probably benign 0.21
R4760:Camk1d UTSW 2 5362056 missense probably damaging 1.00
R4894:Camk1d UTSW 2 5354728 missense probably damaging 1.00
R5001:Camk1d UTSW 2 5313101 missense possibly damaging 0.50
R5394:Camk1d UTSW 2 5303366 missense probably benign 0.10
R5754:Camk1d UTSW 2 5445097 missense probably benign 0.10
R5754:Camk1d UTSW 2 5445099 missense probably damaging 1.00
R5877:Camk1d UTSW 2 5565665 missense probably benign 0.00
R6444:Camk1d UTSW 2 5313145 missense probably damaging 1.00
R7315:Camk1d UTSW 2 5339230 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGCATCCTGAGGGCATCAAAAG -3'
(R):5'- CCAAAGCATCTCTCTAAGGCAGCG -3'

Sequencing Primer
(F):5'- TGCCAACACTGGCTTAGGAG -3'
(R):5'- TCTCTCTAAGGCAGCGATGAATG -3'
Posted On2014-04-24