Incidental Mutation 'R1628:Myo3b'
ID 172586
Institutional Source Beutler Lab
Gene Symbol Myo3b
Ensembl Gene ENSMUSG00000042064
Gene Name myosin IIIB
Synonyms A430065P19Rik
MMRRC Submission 039665-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1628 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 69869470-70259542 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 70117306 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 913 (N913S)
Ref Sequence ENSEMBL: ENSMUSP00000107862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060208] [ENSMUST00000112243]
AlphaFold Q1EG27
Predicted Effect probably benign
Transcript: ENSMUST00000060208
AA Change: N941S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000055362
Gene: ENSMUSG00000042064
AA Change: N941S

DomainStartEndE-ValueType
S_TKc 43 309 2.24e-85 SMART
MYSc 353 1075 6.61e-260 SMART
IQ 1075 1097 9.51e1 SMART
IQ 1102 1124 1.73e-5 SMART
low complexity region 1319 1324 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112243
AA Change: N913S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000107862
Gene: ENSMUSG00000042064
AA Change: N913S

DomainStartEndE-ValueType
S_TKc 15 281 2.24e-85 SMART
MYSc 325 1047 6.61e-260 SMART
IQ 1047 1069 9.51e1 SMART
IQ 1074 1096 1.73e-5 SMART
low complexity region 1291 1296 N/A INTRINSIC
Meta Mutation Damage Score 0.0868 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the class III myosins. Myosins are ATPases, activated by actin, that move along actin filaments in the cell. This class of myosins are characterized by an amino-terminal kinase domain and shown to be present in photoreceptors. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 C T 17: 84,999,419 (GRCm39) Q172* probably null Het
AI467606 G A 7: 126,691,755 (GRCm39) G110D probably benign Het
Arhgef15 A C 11: 68,835,640 (GRCm39) L805R possibly damaging Het
B3galnt1 G A 3: 69,482,961 (GRCm39) T100I probably damaging Het
Bod1l T A 5: 41,974,325 (GRCm39) M2330L probably benign Het
Calcr A T 6: 3,700,251 (GRCm39) H280Q possibly damaging Het
Camk1d T C 2: 5,315,848 (GRCm39) D263G probably damaging Het
Cd48 T A 1: 171,532,420 (GRCm39) I233N probably damaging Het
Cyp3a25 A T 5: 145,938,273 (GRCm39) Y68* probably null Het
Dapk3 C A 10: 81,027,643 (GRCm39) T227K possibly damaging Het
Dnajc22 A G 15: 98,998,817 (GRCm39) M1V probably null Het
Etv5 C T 16: 22,220,421 (GRCm39) probably null Het
Gabrr1 A G 4: 33,152,432 (GRCm39) Y124C probably damaging Het
Gba2 C T 4: 43,570,118 (GRCm39) R392Q probably benign Het
Gli3 C G 13: 15,900,897 (GRCm39) A1428G probably benign Het
Gls G A 1: 52,271,835 (GRCm39) A106V probably benign Het
Gm21370 A G 13: 120,488,414 (GRCm39) V45A possibly damaging Het
Gpr4 A G 7: 18,957,124 (GRCm39) T349A probably benign Het
Gpr6 C T 10: 40,947,544 (GRCm39) V13M possibly damaging Het
Gvin3 A T 7: 106,202,476 (GRCm39) L256* probably null Het
Hectd3 A G 4: 116,854,589 (GRCm39) H345R probably damaging Het
Igfl3 A T 7: 17,914,232 (GRCm39) K135N probably benign Het
Il23r A G 6: 67,400,593 (GRCm39) L579S probably damaging Het
Itsn2 A C 12: 4,679,652 (GRCm39) M154L probably benign Het
Junb T A 8: 85,705,039 (GRCm39) Q7L possibly damaging Het
Kif21b T A 1: 136,098,958 (GRCm39) H1415Q probably benign Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Klhdc10 T G 6: 30,444,461 (GRCm39) F79L probably damaging Het
Klk1b8 A G 7: 43,603,565 (GRCm39) probably null Het
Lmbrd2 T A 15: 9,182,593 (GRCm39) N509K probably damaging Het
Mctp2 A G 7: 71,861,337 (GRCm39) probably null Het
N4bp2 G A 5: 65,960,915 (GRCm39) probably null Het
Nt5c1a A G 4: 123,102,284 (GRCm39) E70G possibly damaging Het
Or12k5 A G 2: 36,894,738 (GRCm39) V296A probably damaging Het
Papln A G 12: 83,831,180 (GRCm39) probably benign Het
Pcnx3 G T 19: 5,736,093 (GRCm39) S244R probably damaging Het
Pecam1 A T 11: 106,573,786 (GRCm39) probably null Het
Plppr4 A T 3: 117,121,921 (GRCm39) L219Q probably damaging Het
Ppp2r5b A G 19: 6,280,935 (GRCm39) probably null Het
Ralgapb A G 2: 158,272,383 (GRCm39) R146G probably benign Het
Rapgef6 TG TGG 11: 54,437,223 (GRCm39) probably null Het
Rfpl4b T G 10: 38,697,530 (GRCm39) I24L probably benign Het
Serpinb1b G A 13: 33,277,637 (GRCm39) C290Y probably benign Het
Skic3 A G 13: 76,259,910 (GRCm39) E70G possibly damaging Het
Slc25a17 A G 15: 81,244,925 (GRCm39) S3P possibly damaging Het
Slc4a11 A C 2: 130,529,047 (GRCm39) probably null Het
Spata31e4 T C 13: 50,856,324 (GRCm39) L654P probably benign Het
Sptb A G 12: 76,630,622 (GRCm39) Y2231H probably damaging Het
Srgap1 T G 10: 121,706,244 (GRCm39) M221L probably benign Het
Srgap3 A G 6: 112,716,331 (GRCm39) L599P probably damaging Het
Svep1 C T 4: 58,107,561 (GRCm39) V1177M probably benign Het
Tarbp1 A G 8: 127,157,599 (GRCm39) F1303L possibly damaging Het
Tbxa2r T C 10: 81,170,341 (GRCm39) S276P possibly damaging Het
Try10 A T 6: 41,334,390 (GRCm39) D194V probably damaging Het
Ttc39c T C 18: 12,867,936 (GRCm39) probably benign Het
Ttc8 G A 12: 98,948,780 (GRCm39) V489M probably benign Het
Unc13b G T 4: 43,263,371 (GRCm39) R1912L probably damaging Het
Unc45b T A 11: 82,820,206 (GRCm39) probably null Het
Usp17lb T C 7: 104,490,048 (GRCm39) Y292C probably damaging Het
Usp34 A G 11: 23,438,725 (GRCm39) D3429G probably damaging Het
Usp42 A G 5: 143,703,122 (GRCm39) S500P probably damaging Het
Vmn2r14 T C 5: 109,367,838 (GRCm39) M385V probably benign Het
Vmn2r60 G A 7: 41,785,830 (GRCm39) W211* probably null Het
Vwf A T 6: 125,624,701 (GRCm39) probably benign Het
Wdfy4 A T 14: 32,681,918 (GRCm39) F3018I probably damaging Het
Wwox A G 8: 115,174,973 (GRCm39) T102A probably benign Het
Zfp142 A C 1: 74,611,047 (GRCm39) L813R possibly damaging Het
Zfp407 G A 18: 84,372,658 (GRCm39) T1670M probably damaging Het
Zfp93 A G 7: 23,974,282 (GRCm39) E89G probably benign Het
Zwint C T 10: 72,492,127 (GRCm39) Q18* probably null Het
Other mutations in Myo3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Myo3b APN 2 69,935,989 (GRCm39) splice site probably benign
IGL00959:Myo3b APN 2 70,144,636 (GRCm39) missense probably damaging 1.00
IGL01069:Myo3b APN 2 70,075,735 (GRCm39) missense probably benign 0.22
IGL01116:Myo3b APN 2 70,119,730 (GRCm39) missense probably damaging 1.00
IGL02097:Myo3b APN 2 70,069,173 (GRCm39) missense probably damaging 1.00
IGL02220:Myo3b APN 2 70,119,923 (GRCm39) splice site probably benign
IGL02553:Myo3b APN 2 69,925,568 (GRCm39) missense probably benign 0.00
IGL02557:Myo3b APN 2 70,085,663 (GRCm39) missense probably benign 0.16
IGL02648:Myo3b APN 2 69,935,716 (GRCm39) splice site probably benign
IGL02902:Myo3b APN 2 70,119,745 (GRCm39) missense probably benign 0.36
IGL02981:Myo3b APN 2 69,938,969 (GRCm39) missense probably damaging 1.00
IGL03030:Myo3b APN 2 70,257,160 (GRCm39) splice site probably benign
IGL03031:Myo3b APN 2 70,085,721 (GRCm39) missense possibly damaging 0.64
IGL03068:Myo3b APN 2 70,257,160 (GRCm39) splice site probably benign
IGL03078:Myo3b APN 2 70,117,335 (GRCm39) missense probably damaging 1.00
IGL03224:Myo3b APN 2 70,180,283 (GRCm39) missense probably benign
IGL03329:Myo3b APN 2 70,084,803 (GRCm39) missense probably damaging 1.00
R0079:Myo3b UTSW 2 69,925,502 (GRCm39) missense possibly damaging 0.58
R0226:Myo3b UTSW 2 70,047,510 (GRCm39) missense probably benign 0.00
R0238:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0238:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0239:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0239:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0313:Myo3b UTSW 2 70,179,303 (GRCm39) nonsense probably null
R0331:Myo3b UTSW 2 69,925,605 (GRCm39) missense probably damaging 1.00
R0371:Myo3b UTSW 2 70,083,304 (GRCm39) splice site probably benign
R0442:Myo3b UTSW 2 70,069,305 (GRCm39) critical splice donor site probably null
R0964:Myo3b UTSW 2 70,257,193 (GRCm39) missense probably damaging 1.00
R1217:Myo3b UTSW 2 70,161,224 (GRCm39) missense probably benign 0.02
R1429:Myo3b UTSW 2 70,083,351 (GRCm39) missense probably damaging 0.97
R1460:Myo3b UTSW 2 70,062,798 (GRCm39) missense probably benign 0.31
R1617:Myo3b UTSW 2 70,111,562 (GRCm39) missense probably benign 0.00
R1708:Myo3b UTSW 2 70,075,729 (GRCm39) nonsense probably null
R1940:Myo3b UTSW 2 70,088,419 (GRCm39) missense probably benign 0.01
R2407:Myo3b UTSW 2 70,085,597 (GRCm39) missense probably damaging 1.00
R3081:Myo3b UTSW 2 70,086,927 (GRCm39) splice site probably benign
R3687:Myo3b UTSW 2 70,075,658 (GRCm39) missense probably benign
R3745:Myo3b UTSW 2 70,064,829 (GRCm39) splice site probably benign
R4011:Myo3b UTSW 2 69,926,720 (GRCm39) missense probably benign 0.15
R4074:Myo3b UTSW 2 70,119,808 (GRCm39) missense probably damaging 1.00
R4419:Myo3b UTSW 2 69,926,706 (GRCm39) missense probably damaging 1.00
R4496:Myo3b UTSW 2 70,084,748 (GRCm39) missense probably benign
R4539:Myo3b UTSW 2 69,869,491 (GRCm39) start codon destroyed probably null 0.00
R4643:Myo3b UTSW 2 70,069,186 (GRCm39) missense possibly damaging 0.49
R4657:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
R4807:Myo3b UTSW 2 69,936,056 (GRCm39) missense probably damaging 1.00
R4849:Myo3b UTSW 2 70,075,253 (GRCm39) missense probably damaging 0.98
R4997:Myo3b UTSW 2 70,088,427 (GRCm39) missense possibly damaging 0.49
R5008:Myo3b UTSW 2 70,088,412 (GRCm39) missense probably damaging 0.99
R5070:Myo3b UTSW 2 70,083,456 (GRCm39) missense probably damaging 1.00
R5072:Myo3b UTSW 2 69,925,593 (GRCm39) missense possibly damaging 0.96
R5082:Myo3b UTSW 2 70,088,374 (GRCm39) missense probably benign 0.01
R5103:Myo3b UTSW 2 69,926,747 (GRCm39) missense probably benign 0.08
R5109:Myo3b UTSW 2 69,925,637 (GRCm39) missense possibly damaging 0.66
R5304:Myo3b UTSW 2 70,257,232 (GRCm39) missense probably damaging 0.97
R5396:Myo3b UTSW 2 69,957,329 (GRCm39) missense probably damaging 0.99
R5400:Myo3b UTSW 2 69,935,724 (GRCm39) missense probably damaging 1.00
R5468:Myo3b UTSW 2 70,064,785 (GRCm39) missense probably benign 0.00
R5620:Myo3b UTSW 2 70,069,254 (GRCm39) missense probably benign 0.04
R5646:Myo3b UTSW 2 70,144,774 (GRCm39) missense probably damaging 0.97
R5729:Myo3b UTSW 2 69,936,083 (GRCm39) missense probably damaging 1.00
R5943:Myo3b UTSW 2 70,117,285 (GRCm39) missense probably benign 0.03
R5971:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
R6091:Myo3b UTSW 2 70,069,113 (GRCm39) missense probably benign 0.00
R6138:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
R6164:Myo3b UTSW 2 70,075,754 (GRCm39) critical splice donor site probably null
R6177:Myo3b UTSW 2 70,143,707 (GRCm39) missense probably benign 0.00
R6421:Myo3b UTSW 2 70,143,700 (GRCm39) missense probably benign 0.02
R6478:Myo3b UTSW 2 70,179,304 (GRCm39) missense probably benign
R6606:Myo3b UTSW 2 70,062,829 (GRCm39) missense possibly damaging 0.94
R6752:Myo3b UTSW 2 70,119,856 (GRCm39) missense probably damaging 1.00
R6982:Myo3b UTSW 2 70,256,409 (GRCm39) missense probably benign 0.02
R6997:Myo3b UTSW 2 69,957,329 (GRCm39) missense probably damaging 0.99
R7032:Myo3b UTSW 2 69,925,608 (GRCm39) missense probably damaging 0.98
R7038:Myo3b UTSW 2 69,925,552 (GRCm39) missense probably benign 0.00
R7062:Myo3b UTSW 2 70,047,501 (GRCm39) missense probably benign 0.00
R7537:Myo3b UTSW 2 70,047,513 (GRCm39) missense probably benign 0.01
R7861:Myo3b UTSW 2 69,939,032 (GRCm39) missense probably damaging 1.00
R7955:Myo3b UTSW 2 69,925,623 (GRCm39) missense probably benign 0.37
R7977:Myo3b UTSW 2 70,161,277 (GRCm39) missense probably benign
R7978:Myo3b UTSW 2 70,083,458 (GRCm39) missense probably damaging 1.00
R7987:Myo3b UTSW 2 70,161,277 (GRCm39) missense probably benign
R8803:Myo3b UTSW 2 70,083,338 (GRCm39) missense probably benign
R8843:Myo3b UTSW 2 70,088,325 (GRCm39) missense probably damaging 1.00
R8896:Myo3b UTSW 2 70,069,160 (GRCm39) missense probably damaging 1.00
R8904:Myo3b UTSW 2 70,257,252 (GRCm39) missense probably benign 0.07
R8909:Myo3b UTSW 2 70,083,440 (GRCm39) missense probably damaging 1.00
R9031:Myo3b UTSW 2 70,082,094 (GRCm39) missense probably damaging 0.99
R9052:Myo3b UTSW 2 70,062,747 (GRCm39) missense probably benign 0.00
R9251:Myo3b UTSW 2 70,088,425 (GRCm39) nonsense probably null
R9268:Myo3b UTSW 2 70,257,305 (GRCm39) makesense probably null
R9334:Myo3b UTSW 2 70,047,360 (GRCm39) missense probably damaging 1.00
R9377:Myo3b UTSW 2 70,069,242 (GRCm39) missense possibly damaging 0.78
R9457:Myo3b UTSW 2 69,925,553 (GRCm39) missense probably benign 0.01
R9520:Myo3b UTSW 2 70,062,753 (GRCm39) missense possibly damaging 0.67
R9593:Myo3b UTSW 2 70,075,648 (GRCm39) missense probably benign 0.43
R9671:Myo3b UTSW 2 70,086,908 (GRCm39) missense probably damaging 1.00
R9790:Myo3b UTSW 2 70,180,287 (GRCm39) missense probably benign 0.35
R9791:Myo3b UTSW 2 70,180,287 (GRCm39) missense probably benign 0.35
U15987:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
X0025:Myo3b UTSW 2 70,062,747 (GRCm39) missense probably benign 0.00
X0065:Myo3b UTSW 2 70,088,313 (GRCm39) missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70,088,371 (GRCm39) missense probably benign 0.01
Z1177:Myo3b UTSW 2 69,926,705 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGAAGTCTCCTCACAGTGTACCC -3'
(R):5'- CTTAACTGGCATTTGTGTTTGGCCC -3'

Sequencing Primer
(F):5'- CAGTGTACCCAGTTATGTCCTAAAC -3'
(R):5'- gattttctctccttgctgcc -3'
Posted On 2014-04-24