Incidental Mutation 'R1628:Gba2'
ID172593
Institutional Source Beutler Lab
Gene Symbol Gba2
Ensembl Gene ENSMUSG00000028467
Gene Nameglucosidase beta 2
Synonymsbile acid
MMRRC Submission 039665-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1628 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location43566928-43578873 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 43570118 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 392 (R392Q)
Ref Sequence ENSEMBL: ENSMUSP00000030189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030189] [ENSMUST00000102944] [ENSMUST00000130443] [ENSMUST00000132631] [ENSMUST00000167751]
Predicted Effect probably benign
Transcript: ENSMUST00000030189
AA Change: R392Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000030189
Gene: ENSMUSG00000028467
AA Change: R392Q

DomainStartEndE-ValueType
Pfam:GBA2_N 142 446 9.4e-106 PFAM
Pfam:DUF608 512 879 1.3e-153 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102944
SMART Domains Protein: ENSMUSP00000100008
Gene: ENSMUSG00000028466

DomainStartEndE-ValueType
low complexity region 54 83 N/A INTRINSIC
low complexity region 132 147 N/A INTRINSIC
BRLZ 158 222 2.03e-15 SMART
low complexity region 240 253 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126277
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128403
Predicted Effect probably benign
Transcript: ENSMUST00000130443
SMART Domains Protein: ENSMUSP00000119589
Gene: ENSMUSG00000028467

DomainStartEndE-ValueType
Pfam:GBA2_N 142 180 5.6e-13 PFAM
Pfam:GBA2_N 178 227 1.5e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132631
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138623
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139606
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144968
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148426
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152251
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159923
Predicted Effect probably benign
Transcript: ENSMUST00000167751
SMART Domains Protein: ENSMUSP00000129401
Gene: ENSMUSG00000028466

DomainStartEndE-ValueType
low complexity region 54 83 N/A INTRINSIC
low complexity region 156 171 N/A INTRINSIC
BRLZ 182 246 2.03e-15 SMART
low complexity region 264 277 N/A INTRINSIC
Meta Mutation Damage Score 0.0652 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a microsomal beta-glucosidase that catalyzes the hydrolysis of bile acid 3-O-glucosides as endogenous compounds. Studies to determine subcellular localization of this protein in the liver indicated that the enzyme was mainly enriched in the microsomal fraction where it appeared to be confined to the endoplasmic reticulum. This putative transmembrane protein is thought to play a role in carbohydrate transport and metabolism. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit accumulation of glucosylceramides in multiple tissues, and show impaired male fertility associated with globozoospermia, oligozoospermia, reduced sperm motility, and male germ cell apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 C T 17: 84,691,991 Q172* probably null Het
AI467606 G A 7: 127,092,583 G110D probably benign Het
Arhgef15 A C 11: 68,944,814 L805R possibly damaging Het
B3galnt1 G A 3: 69,575,628 T100I probably damaging Het
Bod1l T A 5: 41,816,982 M2330L probably benign Het
Calcr A T 6: 3,700,251 H280Q possibly damaging Het
Camk1d T C 2: 5,311,037 D263G probably damaging Het
Cd48 T A 1: 171,704,852 I233N probably damaging Het
Cyp3a25 A T 5: 146,001,463 Y68* probably null Het
Dapk3 C A 10: 81,191,809 T227K possibly damaging Het
Dnajc22 A G 15: 99,100,936 M1V probably null Het
Etv5 C T 16: 22,401,671 probably null Het
Gabrr1 A G 4: 33,152,432 Y124C probably damaging Het
Gli3 C G 13: 15,726,312 A1428G probably benign Het
Gls G A 1: 52,232,676 A106V probably benign Het
Gm1966 A T 7: 106,603,269 L256* probably null Het
Gm21370 A G 13: 120,026,878 V45A possibly damaging Het
Gm8765 T C 13: 50,702,288 L654P probably benign Het
Gpr4 A G 7: 19,223,199 T349A probably benign Het
Gpr6 C T 10: 41,071,548 V13M possibly damaging Het
Hectd3 A G 4: 116,997,392 H345R probably damaging Het
Igfl3 A T 7: 18,180,307 K135N probably benign Het
Il23r A G 6: 67,423,609 L579S probably damaging Het
Itsn2 A C 12: 4,629,652 M154L probably benign Het
Junb T A 8: 84,978,410 Q7L possibly damaging Het
Kif21b T A 1: 136,171,220 H1415Q probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klhdc10 T G 6: 30,444,462 F79L probably damaging Het
Klk1b8 A G 7: 43,954,141 probably null Het
Lmbrd2 T A 15: 9,182,506 N509K probably damaging Het
Mctp2 A G 7: 72,211,589 probably null Het
Myo3b A G 2: 70,286,962 N913S probably benign Het
N4bp2 G A 5: 65,803,572 probably null Het
Nt5c1a A G 4: 123,208,491 E70G possibly damaging Het
Olfr358 A G 2: 37,004,726 V296A probably damaging Het
Papln A G 12: 83,784,406 probably benign Het
Pcnx3 G T 19: 5,686,065 S244R probably damaging Het
Pecam1 A T 11: 106,682,960 probably null Het
Plppr4 A T 3: 117,328,272 L219Q probably damaging Het
Ppp2r5b A G 19: 6,230,905 probably null Het
Ralgapb A G 2: 158,430,463 R146G probably benign Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Rfpl4b T G 10: 38,821,534 I24L probably benign Het
Serpinb1b G A 13: 33,093,654 C290Y probably benign Het
Slc25a17 A G 15: 81,360,724 S3P possibly damaging Het
Slc4a11 A C 2: 130,687,127 probably null Het
Sptb A G 12: 76,583,848 Y2231H probably damaging Het
Srgap1 T G 10: 121,870,339 M221L probably benign Het
Srgap3 A G 6: 112,739,370 L599P probably damaging Het
Svep1 C T 4: 58,107,561 V1177M probably benign Het
Tarbp1 A G 8: 126,430,860 F1303L possibly damaging Het
Tbxa2r T C 10: 81,334,507 S276P possibly damaging Het
Try10 A T 6: 41,357,456 D194V probably damaging Het
Ttc37 A G 13: 76,111,791 E70G possibly damaging Het
Ttc39c T C 18: 12,734,879 probably benign Het
Ttc8 G A 12: 98,982,521 V489M probably benign Het
Unc13b G T 4: 43,263,371 R1912L probably damaging Het
Unc45b T A 11: 82,929,380 probably null Het
Usp17lb T C 7: 104,840,841 Y292C probably damaging Het
Usp34 A G 11: 23,488,725 D3429G probably damaging Het
Usp42 A G 5: 143,717,367 S500P probably damaging Het
Vmn2r14 T C 5: 109,219,972 M385V probably benign Het
Vmn2r60 G A 7: 42,136,406 W211* probably null Het
Vwf A T 6: 125,647,738 probably benign Het
Wdfy4 A T 14: 32,959,961 F3018I probably damaging Het
Wwox A G 8: 114,448,233 T102A probably benign Het
Zfp142 A C 1: 74,571,888 L813R possibly damaging Het
Zfp407 G A 18: 84,354,533 T1670M probably damaging Het
Zfp93 A G 7: 24,274,857 E89G probably benign Het
Zwint C T 10: 72,656,295 Q18* probably null Het
Other mutations in Gba2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Gba2 APN 4 43568477 missense probably damaging 1.00
IGL01577:Gba2 APN 4 43573753 nonsense probably null
IGL02066:Gba2 APN 4 43570175 missense probably benign 0.18
IGL02126:Gba2 APN 4 43567918 critical splice acceptor site probably null
IGL02243:Gba2 APN 4 43568719 missense probably benign 0.13
IGL02474:Gba2 APN 4 43568538 missense possibly damaging 0.69
IGL02567:Gba2 APN 4 43567281 missense probably benign
IGL02628:Gba2 APN 4 43568919 missense probably benign 0.01
IGL02706:Gba2 APN 4 43567257 missense probably benign 0.01
IGL02795:Gba2 APN 4 43578331 missense probably damaging 1.00
R0389:Gba2 UTSW 4 43570832 missense probably damaging 1.00
R0555:Gba2 UTSW 4 43569927 missense probably damaging 1.00
R0650:Gba2 UTSW 4 43570424 unclassified probably null
R1603:Gba2 UTSW 4 43567823 missense probably damaging 1.00
R1664:Gba2 UTSW 4 43578080 missense probably benign 0.01
R1686:Gba2 UTSW 4 43573869 splice site probably benign
R1730:Gba2 UTSW 4 43578242 missense probably benign 0.01
R2036:Gba2 UTSW 4 43568118 unclassified probably benign
R2061:Gba2 UTSW 4 43574029 nonsense probably null
R2259:Gba2 UTSW 4 43570107 missense probably benign
R2847:Gba2 UTSW 4 43568000 unclassified probably null
R3026:Gba2 UTSW 4 43578308 missense possibly damaging 0.95
R3617:Gba2 UTSW 4 43573803 missense probably damaging 1.00
R4225:Gba2 UTSW 4 43569464 unclassified probably benign
R4346:Gba2 UTSW 4 43571337 missense probably benign 0.04
R4601:Gba2 UTSW 4 43573810 missense probably damaging 1.00
R4611:Gba2 UTSW 4 43568092 missense probably damaging 1.00
R4664:Gba2 UTSW 4 43568619 unclassified probably benign
R4784:Gba2 UTSW 4 43568315 missense probably damaging 1.00
R4785:Gba2 UTSW 4 43568315 missense probably damaging 1.00
R5079:Gba2 UTSW 4 43568640 unclassified probably benign
R5327:Gba2 UTSW 4 43574063 missense probably damaging 1.00
R5746:Gba2 UTSW 4 43568465 unclassified probably null
R6052:Gba2 UTSW 4 43568330 missense probably damaging 1.00
R6485:Gba2 UTSW 4 43574118 missense probably damaging 1.00
R7073:Gba2 UTSW 4 43573753 missense probably damaging 1.00
R7112:Gba2 UTSW 4 43568453 missense probably benign 0.01
R7472:Gba2 UTSW 4 43568967 missense probably benign 0.44
RF007:Gba2 UTSW 4 43569894 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGTGGCACAGTGCATAGTGGCTC -3'
(R):5'- TGTGGCAGGACCTACTTCAGGATG -3'

Sequencing Primer
(F):5'- CATAGTGGCTCAGGGCAG -3'
(R):5'- AAGAAAGGCTCTGTCCTGTC -3'
Posted On2014-04-24