Incidental Mutation 'R1628:Usp34'
ID 172627
Institutional Source Beutler Lab
Gene Symbol Usp34
Ensembl Gene ENSMUSG00000056342
Gene Name ubiquitin specific peptidase 34
Synonyms Murr2, A530081C03Rik
MMRRC Submission 039665-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.803) question?
Stock # R1628 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 23256895-23440560 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 23438725 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 3429 (D3429G)
Ref Sequence ENSEMBL: ENSMUSP00000137430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020529] [ENSMUST00000109539] [ENSMUST00000180046] [ENSMUST00000128559] [ENSMUST00000129368] [ENSMUST00000147157]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000020529
SMART Domains Protein: ENSMUSP00000020529
Gene: ENSMUSG00000020288

DomainStartEndE-ValueType
Aha1_N 29 163 2.52e-57 SMART
Pfam:AHSA1 209 325 1.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109539
SMART Domains Protein: ENSMUSP00000105166
Gene: ENSMUSG00000020288

DomainStartEndE-ValueType
Aha1_N 2 115 2.33e-38 SMART
Pfam:AHSA1 161 277 4.3e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122864
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124801
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125701
Predicted Effect probably benign
Transcript: ENSMUST00000128372
SMART Domains Protein: ENSMUSP00000121255
Gene: ENSMUSG00000020288

DomainStartEndE-ValueType
Aha1_N 15 149 2.52e-57 SMART
Pfam:AHSA1 195 311 7.5e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000180046
AA Change: D3429G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137430
Gene: ENSMUSG00000056342
AA Change: D3429G

DomainStartEndE-ValueType
low complexity region 469 480 N/A INTRINSIC
low complexity region 510 524 N/A INTRINSIC
low complexity region 571 590 N/A INTRINSIC
coiled coil region 607 652 N/A INTRINSIC
low complexity region 807 822 N/A INTRINSIC
low complexity region 1187 1198 N/A INTRINSIC
low complexity region 1379 1390 N/A INTRINSIC
low complexity region 1498 1512 N/A INTRINSIC
low complexity region 1731 1744 N/A INTRINSIC
low complexity region 1792 1804 N/A INTRINSIC
Pfam:UCH 1930 2273 2.3e-44 PFAM
Pfam:UCH_1 1931 2229 1.1e-22 PFAM
low complexity region 2522 2544 N/A INTRINSIC
low complexity region 2652 2659 N/A INTRINSIC
Blast:Drf_GBD 2923 3096 2e-53 BLAST
low complexity region 3324 3337 N/A INTRINSIC
coiled coil region 3352 3374 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000137823
AA Change: D3448G
SMART Domains Protein: ENSMUSP00000120747
Gene: ENSMUSG00000056342
AA Change: D3448G

DomainStartEndE-ValueType
low complexity region 489 500 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 591 610 N/A INTRINSIC
coiled coil region 626 671 N/A INTRINSIC
low complexity region 827 842 N/A INTRINSIC
low complexity region 1207 1218 N/A INTRINSIC
low complexity region 1399 1410 N/A INTRINSIC
low complexity region 1518 1532 N/A INTRINSIC
low complexity region 1751 1764 N/A INTRINSIC
low complexity region 1812 1824 N/A INTRINSIC
Pfam:UCH 1950 2293 7.6e-44 PFAM
Pfam:UCH_1 1951 2249 3.6e-22 PFAM
low complexity region 2542 2564 N/A INTRINSIC
low complexity region 2672 2679 N/A INTRINSIC
Blast:Drf_GBD 2943 3116 3e-53 BLAST
low complexity region 3344 3357 N/A INTRINSIC
coiled coil region 3371 3393 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153409
Predicted Effect probably benign
Transcript: ENSMUST00000128559
SMART Domains Protein: ENSMUSP00000115134
Gene: ENSMUSG00000020288

DomainStartEndE-ValueType
Aha1_N 29 159 1.59e-54 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129368
SMART Domains Protein: ENSMUSP00000121426
Gene: ENSMUSG00000056342

DomainStartEndE-ValueType
Blast:Drf_GBD 2 86 1e-19 BLAST
low complexity region 231 244 N/A INTRINSIC
coiled coil region 259 281 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147157
SMART Domains Protein: ENSMUSP00000121920
Gene: ENSMUSG00000020288

DomainStartEndE-ValueType
Aha1_N 29 138 4.15e-26 SMART
Meta Mutation Damage Score 0.2553 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency 99% (75/76)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 C T 17: 84,999,419 (GRCm39) Q172* probably null Het
AI467606 G A 7: 126,691,755 (GRCm39) G110D probably benign Het
Arhgef15 A C 11: 68,835,640 (GRCm39) L805R possibly damaging Het
B3galnt1 G A 3: 69,482,961 (GRCm39) T100I probably damaging Het
Bod1l T A 5: 41,974,325 (GRCm39) M2330L probably benign Het
Calcr A T 6: 3,700,251 (GRCm39) H280Q possibly damaging Het
Camk1d T C 2: 5,315,848 (GRCm39) D263G probably damaging Het
Cd48 T A 1: 171,532,420 (GRCm39) I233N probably damaging Het
Cyp3a25 A T 5: 145,938,273 (GRCm39) Y68* probably null Het
Dapk3 C A 10: 81,027,643 (GRCm39) T227K possibly damaging Het
Dnajc22 A G 15: 98,998,817 (GRCm39) M1V probably null Het
Etv5 C T 16: 22,220,421 (GRCm39) probably null Het
Gabrr1 A G 4: 33,152,432 (GRCm39) Y124C probably damaging Het
Gba2 C T 4: 43,570,118 (GRCm39) R392Q probably benign Het
Gli3 C G 13: 15,900,897 (GRCm39) A1428G probably benign Het
Gls G A 1: 52,271,835 (GRCm39) A106V probably benign Het
Gm21370 A G 13: 120,488,414 (GRCm39) V45A possibly damaging Het
Gpr4 A G 7: 18,957,124 (GRCm39) T349A probably benign Het
Gpr6 C T 10: 40,947,544 (GRCm39) V13M possibly damaging Het
Gvin3 A T 7: 106,202,476 (GRCm39) L256* probably null Het
Hectd3 A G 4: 116,854,589 (GRCm39) H345R probably damaging Het
Igfl3 A T 7: 17,914,232 (GRCm39) K135N probably benign Het
Il23r A G 6: 67,400,593 (GRCm39) L579S probably damaging Het
Itsn2 A C 12: 4,679,652 (GRCm39) M154L probably benign Het
Junb T A 8: 85,705,039 (GRCm39) Q7L possibly damaging Het
Kif21b T A 1: 136,098,958 (GRCm39) H1415Q probably benign Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Klhdc10 T G 6: 30,444,461 (GRCm39) F79L probably damaging Het
Klk1b8 A G 7: 43,603,565 (GRCm39) probably null Het
Lmbrd2 T A 15: 9,182,593 (GRCm39) N509K probably damaging Het
Mctp2 A G 7: 71,861,337 (GRCm39) probably null Het
Myo3b A G 2: 70,117,306 (GRCm39) N913S probably benign Het
N4bp2 G A 5: 65,960,915 (GRCm39) probably null Het
Nt5c1a A G 4: 123,102,284 (GRCm39) E70G possibly damaging Het
Or12k5 A G 2: 36,894,738 (GRCm39) V296A probably damaging Het
Papln A G 12: 83,831,180 (GRCm39) probably benign Het
Pcnx3 G T 19: 5,736,093 (GRCm39) S244R probably damaging Het
Pecam1 A T 11: 106,573,786 (GRCm39) probably null Het
Plppr4 A T 3: 117,121,921 (GRCm39) L219Q probably damaging Het
Ppp2r5b A G 19: 6,280,935 (GRCm39) probably null Het
Ralgapb A G 2: 158,272,383 (GRCm39) R146G probably benign Het
Rapgef6 TG TGG 11: 54,437,223 (GRCm39) probably null Het
Rfpl4b T G 10: 38,697,530 (GRCm39) I24L probably benign Het
Serpinb1b G A 13: 33,277,637 (GRCm39) C290Y probably benign Het
Skic3 A G 13: 76,259,910 (GRCm39) E70G possibly damaging Het
Slc25a17 A G 15: 81,244,925 (GRCm39) S3P possibly damaging Het
Slc4a11 A C 2: 130,529,047 (GRCm39) probably null Het
Spata31e4 T C 13: 50,856,324 (GRCm39) L654P probably benign Het
Sptb A G 12: 76,630,622 (GRCm39) Y2231H probably damaging Het
Srgap1 T G 10: 121,706,244 (GRCm39) M221L probably benign Het
Srgap3 A G 6: 112,716,331 (GRCm39) L599P probably damaging Het
Svep1 C T 4: 58,107,561 (GRCm39) V1177M probably benign Het
Tarbp1 A G 8: 127,157,599 (GRCm39) F1303L possibly damaging Het
Tbxa2r T C 10: 81,170,341 (GRCm39) S276P possibly damaging Het
Try10 A T 6: 41,334,390 (GRCm39) D194V probably damaging Het
Ttc39c T C 18: 12,867,936 (GRCm39) probably benign Het
Ttc8 G A 12: 98,948,780 (GRCm39) V489M probably benign Het
Unc13b G T 4: 43,263,371 (GRCm39) R1912L probably damaging Het
Unc45b T A 11: 82,820,206 (GRCm39) probably null Het
Usp17lb T C 7: 104,490,048 (GRCm39) Y292C probably damaging Het
Usp42 A G 5: 143,703,122 (GRCm39) S500P probably damaging Het
Vmn2r14 T C 5: 109,367,838 (GRCm39) M385V probably benign Het
Vmn2r60 G A 7: 41,785,830 (GRCm39) W211* probably null Het
Vwf A T 6: 125,624,701 (GRCm39) probably benign Het
Wdfy4 A T 14: 32,681,918 (GRCm39) F3018I probably damaging Het
Wwox A G 8: 115,174,973 (GRCm39) T102A probably benign Het
Zfp142 A C 1: 74,611,047 (GRCm39) L813R possibly damaging Het
Zfp407 G A 18: 84,372,658 (GRCm39) T1670M probably damaging Het
Zfp93 A G 7: 23,974,282 (GRCm39) E89G probably benign Het
Zwint C T 10: 72,492,127 (GRCm39) Q18* probably null Het
Other mutations in Usp34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL00477:Usp34 APN 11 23,418,879 (GRCm39) missense probably damaging 0.99
IGL01307:Usp34 APN 11 23,367,676 (GRCm39) missense probably damaging 0.99
IGL01313:Usp34 APN 11 23,423,206 (GRCm39) missense probably damaging 1.00
IGL01794:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01826:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01827:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01830:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01867:Usp34 APN 11 23,334,411 (GRCm39) missense possibly damaging 0.77
IGL01939:Usp34 APN 11 23,295,141 (GRCm39) splice site probably benign
IGL01977:Usp34 APN 11 23,402,661 (GRCm39) missense probably damaging 1.00
IGL01985:Usp34 APN 11 23,402,565 (GRCm39) missense probably damaging 1.00
IGL02011:Usp34 APN 11 23,421,554 (GRCm39) missense probably damaging 0.99
IGL02302:Usp34 APN 11 23,417,243 (GRCm39) missense possibly damaging 0.91
IGL02423:Usp34 APN 11 23,304,900 (GRCm39) missense probably benign 0.11
IGL02491:Usp34 APN 11 23,382,630 (GRCm39) missense probably damaging 0.98
IGL02532:Usp34 APN 11 23,320,291 (GRCm39) missense probably damaging 0.99
IGL02561:Usp34 APN 11 23,301,652 (GRCm39) missense probably benign 0.09
IGL02706:Usp34 APN 11 23,338,659 (GRCm39) splice site probably benign
IGL02891:Usp34 APN 11 23,437,166 (GRCm39) missense probably benign 0.09
IGL03079:Usp34 APN 11 23,382,247 (GRCm39) missense possibly damaging 0.48
IGL03089:Usp34 APN 11 23,396,958 (GRCm39) missense possibly damaging 0.84
IGL03175:Usp34 APN 11 23,438,686 (GRCm39) missense probably benign
IGL03256:Usp34 APN 11 23,370,090 (GRCm39) nonsense probably null
IGL03280:Usp34 APN 11 23,304,897 (GRCm39) missense probably damaging 1.00
IGL03289:Usp34 APN 11 23,343,818 (GRCm39) missense possibly damaging 0.94
IGL03408:Usp34 APN 11 23,396,957 (GRCm39) missense possibly damaging 0.92
Chub UTSW 11 23,414,686 (GRCm39) missense probably damaging 0.99
Cicione UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R5571_Usp34_680 UTSW 11 23,407,975 (GRCm39) missense probably damaging 0.99
R5713_Usp34_003 UTSW 11 23,293,515 (GRCm39) missense possibly damaging 0.94
Roebuck UTSW 11 23,436,810 (GRCm39) splice site probably benign
stoat UTSW 11 23,437,203 (GRCm39) missense
tunnelvision UTSW 11 23,396,968 (GRCm39) missense
I2288:Usp34 UTSW 11 23,382,473 (GRCm39) splice site probably benign
R0047:Usp34 UTSW 11 23,414,403 (GRCm39) missense probably benign 0.34
R0047:Usp34 UTSW 11 23,414,403 (GRCm39) missense probably benign 0.34
R0099:Usp34 UTSW 11 23,313,111 (GRCm39) missense probably damaging 1.00
R0240:Usp34 UTSW 11 23,383,206 (GRCm39) missense probably damaging 0.99
R0240:Usp34 UTSW 11 23,383,206 (GRCm39) missense probably damaging 0.99
R0403:Usp34 UTSW 11 23,283,838 (GRCm39) missense possibly damaging 0.82
R0432:Usp34 UTSW 11 23,351,505 (GRCm39) missense probably damaging 0.99
R0446:Usp34 UTSW 11 23,417,207 (GRCm39) missense probably damaging 0.97
R0455:Usp34 UTSW 11 23,396,741 (GRCm39) splice site probably benign
R0470:Usp34 UTSW 11 23,386,001 (GRCm39) missense possibly damaging 0.94
R0472:Usp34 UTSW 11 23,334,509 (GRCm39) splice site probably benign
R0512:Usp34 UTSW 11 23,401,997 (GRCm39) missense probably benign 0.04
R0557:Usp34 UTSW 11 23,353,848 (GRCm39) missense probably damaging 0.98
R0562:Usp34 UTSW 11 23,382,406 (GRCm39) splice site probably benign
R0656:Usp34 UTSW 11 23,422,967 (GRCm39) missense probably damaging 0.99
R0693:Usp34 UTSW 11 23,402,637 (GRCm39) missense probably damaging 0.97
R0739:Usp34 UTSW 11 23,417,243 (GRCm39) missense possibly damaging 0.91
R1061:Usp34 UTSW 11 23,334,420 (GRCm39) missense possibly damaging 0.51
R1078:Usp34 UTSW 11 23,383,175 (GRCm39) splice site probably benign
R1223:Usp34 UTSW 11 23,396,464 (GRCm39) splice site probably null
R1295:Usp34 UTSW 11 23,334,477 (GRCm39) missense probably damaging 1.00
R1430:Usp34 UTSW 11 23,409,151 (GRCm39) missense probably damaging 0.97
R1445:Usp34 UTSW 11 23,301,629 (GRCm39) missense probably damaging 0.99
R1468:Usp34 UTSW 11 23,391,171 (GRCm39) missense probably damaging 1.00
R1468:Usp34 UTSW 11 23,391,171 (GRCm39) missense probably damaging 1.00
R1471:Usp34 UTSW 11 23,438,862 (GRCm39) missense probably benign 0.20
R1475:Usp34 UTSW 11 23,423,253 (GRCm39) missense probably damaging 0.99
R1631:Usp34 UTSW 11 23,410,651 (GRCm39) missense probably damaging 0.99
R1655:Usp34 UTSW 11 23,325,051 (GRCm39) missense probably benign 0.05
R1741:Usp34 UTSW 11 23,314,103 (GRCm39) missense probably benign 0.00
R1854:Usp34 UTSW 11 23,376,153 (GRCm39) missense probably benign 0.24
R1867:Usp34 UTSW 11 23,311,593 (GRCm39) missense possibly damaging 0.82
R1869:Usp34 UTSW 11 23,314,479 (GRCm39) missense probably benign 0.37
R1870:Usp34 UTSW 11 23,314,479 (GRCm39) missense probably benign 0.37
R1871:Usp34 UTSW 11 23,314,479 (GRCm39) missense probably benign 0.37
R1967:Usp34 UTSW 11 23,314,503 (GRCm39) missense probably benign 0.01
R2051:Usp34 UTSW 11 23,414,468 (GRCm39) missense probably damaging 0.97
R2132:Usp34 UTSW 11 23,414,556 (GRCm39) missense possibly damaging 0.95
R2156:Usp34 UTSW 11 23,332,602 (GRCm39) missense probably damaging 0.98
R2205:Usp34 UTSW 11 23,335,147 (GRCm39) missense probably damaging 0.97
R2342:Usp34 UTSW 11 23,353,599 (GRCm39) missense possibly damaging 0.46
R3431:Usp34 UTSW 11 23,320,466 (GRCm39) missense possibly damaging 0.95
R3812:Usp34 UTSW 11 23,414,517 (GRCm39) missense possibly damaging 0.94
R3872:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3873:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3874:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3875:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3925:Usp34 UTSW 11 23,293,640 (GRCm39) missense probably benign 0.28
R3972:Usp34 UTSW 11 23,407,803 (GRCm39) missense probably damaging 1.00
R4018:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R4042:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R4155:Usp34 UTSW 11 23,367,676 (GRCm39) missense probably damaging 0.99
R4197:Usp34 UTSW 11 23,394,189 (GRCm39) missense probably damaging 0.98
R4352:Usp34 UTSW 11 23,270,727 (GRCm39) missense possibly damaging 0.73
R4379:Usp34 UTSW 11 23,334,499 (GRCm39) missense possibly damaging 0.52
R4444:Usp34 UTSW 11 23,385,998 (GRCm39) missense probably damaging 0.98
R4475:Usp34 UTSW 11 23,407,975 (GRCm39) missense possibly damaging 0.95
R4501:Usp34 UTSW 11 23,351,529 (GRCm39) missense probably damaging 1.00
R4527:Usp34 UTSW 11 23,371,257 (GRCm39) missense possibly damaging 0.57
R4603:Usp34 UTSW 11 23,414,633 (GRCm39) missense probably damaging 0.97
R4612:Usp34 UTSW 11 23,382,268 (GRCm39) missense probably damaging 0.99
R4673:Usp34 UTSW 11 23,314,480 (GRCm39) small deletion probably benign
R4707:Usp34 UTSW 11 23,437,215 (GRCm39) missense probably damaging 1.00
R4736:Usp34 UTSW 11 23,343,749 (GRCm39) splice site probably null
R4867:Usp34 UTSW 11 23,401,999 (GRCm39) missense probably benign 0.28
R4879:Usp34 UTSW 11 23,323,410 (GRCm39) missense possibly damaging 0.94
R4977:Usp34 UTSW 11 23,438,982 (GRCm39) missense probably damaging 1.00
R5004:Usp34 UTSW 11 23,414,586 (GRCm39) missense probably damaging 1.00
R5057:Usp34 UTSW 11 23,408,086 (GRCm39) intron probably benign
R5068:Usp34 UTSW 11 23,410,665 (GRCm39) missense possibly damaging 0.94
R5304:Usp34 UTSW 11 23,293,616 (GRCm39) missense probably damaging 1.00
R5320:Usp34 UTSW 11 23,283,739 (GRCm39) missense probably benign
R5327:Usp34 UTSW 11 23,418,846 (GRCm39) missense probably damaging 1.00
R5328:Usp34 UTSW 11 23,438,659 (GRCm39) missense probably benign 0.04
R5328:Usp34 UTSW 11 23,414,616 (GRCm39) missense probably benign 0.01
R5390:Usp34 UTSW 11 23,394,202 (GRCm39) critical splice donor site probably null
R5434:Usp34 UTSW 11 23,362,271 (GRCm39) missense probably damaging 0.99
R5523:Usp34 UTSW 11 23,299,198 (GRCm39) missense probably benign 0.39
R5567:Usp34 UTSW 11 23,438,336 (GRCm39) missense probably damaging 0.97
R5571:Usp34 UTSW 11 23,407,975 (GRCm39) missense probably damaging 0.99
R5645:Usp34 UTSW 11 23,325,024 (GRCm39) missense possibly damaging 0.86
R5713:Usp34 UTSW 11 23,293,515 (GRCm39) missense possibly damaging 0.94
R5719:Usp34 UTSW 11 23,304,846 (GRCm39) missense probably benign 0.00
R5813:Usp34 UTSW 11 23,371,340 (GRCm39) missense probably benign 0.38
R5921:Usp34 UTSW 11 23,414,686 (GRCm39) missense probably damaging 0.99
R5928:Usp34 UTSW 11 23,386,040 (GRCm39) missense probably damaging 0.98
R5944:Usp34 UTSW 11 23,313,089 (GRCm39) missense probably damaging 1.00
R6198:Usp34 UTSW 11 23,434,127 (GRCm39) missense probably damaging 1.00
R6229:Usp34 UTSW 11 23,396,778 (GRCm39) missense probably damaging 0.99
R6306:Usp34 UTSW 11 23,362,260 (GRCm39) missense possibly damaging 0.94
R6320:Usp34 UTSW 11 23,402,520 (GRCm39) missense probably damaging 0.98
R6341:Usp34 UTSW 11 23,331,353 (GRCm39) missense probably damaging 0.97
R6374:Usp34 UTSW 11 23,388,914 (GRCm39) missense probably damaging 1.00
R6398:Usp34 UTSW 11 23,438,666 (GRCm39) missense probably benign
R6438:Usp34 UTSW 11 23,314,266 (GRCm39) missense probably benign 0.02
R6668:Usp34 UTSW 11 23,410,659 (GRCm39) missense probably damaging 0.97
R6700:Usp34 UTSW 11 23,389,011 (GRCm39) missense probably damaging 1.00
R6783:Usp34 UTSW 11 23,362,318 (GRCm39) missense probably damaging 1.00
R6821:Usp34 UTSW 11 23,317,491 (GRCm39) missense possibly damaging 0.79
R6855:Usp34 UTSW 11 23,402,569 (GRCm39) missense possibly damaging 0.94
R6916:Usp34 UTSW 11 23,408,023 (GRCm39) missense probably damaging 0.98
R7020:Usp34 UTSW 11 23,343,954 (GRCm39) missense probably benign 0.05
R7026:Usp34 UTSW 11 23,311,622 (GRCm39) missense probably damaging 1.00
R7085:Usp34 UTSW 11 23,313,097 (GRCm39) missense
R7101:Usp34 UTSW 11 23,376,183 (GRCm39) missense
R7168:Usp34 UTSW 11 23,414,585 (GRCm39) missense
R7192:Usp34 UTSW 11 23,410,571 (GRCm39) missense
R7264:Usp34 UTSW 11 23,283,566 (GRCm39) missense probably benign 0.00
R7325:Usp34 UTSW 11 23,369,052 (GRCm39) missense
R7343:Usp34 UTSW 11 23,438,868 (GRCm39) missense
R7358:Usp34 UTSW 11 23,311,683 (GRCm39) missense probably damaging 0.99
R7369:Usp34 UTSW 11 23,382,361 (GRCm39) missense
R7389:Usp34 UTSW 11 23,295,200 (GRCm39) missense
R7459:Usp34 UTSW 11 23,314,458 (GRCm39) missense possibly damaging 0.53
R7517:Usp34 UTSW 11 23,396,968 (GRCm39) missense
R7729:Usp34 UTSW 11 23,399,268 (GRCm39) missense
R7777:Usp34 UTSW 11 23,332,638 (GRCm39) missense
R7810:Usp34 UTSW 11 23,362,314 (GRCm39) missense
R7836:Usp34 UTSW 11 23,396,614 (GRCm39) missense
R7862:Usp34 UTSW 11 23,414,718 (GRCm39) missense
R7993:Usp34 UTSW 11 23,327,622 (GRCm39) missense
R8050:Usp34 UTSW 11 23,396,787 (GRCm39) missense
R8054:Usp34 UTSW 11 23,311,295 (GRCm39) missense
R8239:Usp34 UTSW 11 23,396,750 (GRCm39) missense
R8266:Usp34 UTSW 11 23,436,810 (GRCm39) splice site probably benign
R8347:Usp34 UTSW 11 23,362,345 (GRCm39) missense
R8409:Usp34 UTSW 11 23,407,811 (GRCm39) missense
R8692:Usp34 UTSW 11 23,379,325 (GRCm39) missense
R8694:Usp34 UTSW 11 23,434,161 (GRCm39) missense
R8734:Usp34 UTSW 11 23,394,184 (GRCm39) missense
R8806:Usp34 UTSW 11 23,434,143 (GRCm39) missense
R8914:Usp34 UTSW 11 23,293,604 (GRCm39) missense
R8987:Usp34 UTSW 11 23,414,267 (GRCm39) missense
R9013:Usp34 UTSW 11 23,320,302 (GRCm39) missense
R9108:Usp34 UTSW 11 23,320,528 (GRCm39) missense
R9264:Usp34 UTSW 11 23,439,064 (GRCm39) missense
R9301:Usp34 UTSW 11 23,422,951 (GRCm39) missense
R9375:Usp34 UTSW 11 23,437,203 (GRCm39) missense
R9385:Usp34 UTSW 11 23,399,223 (GRCm39) missense
R9500:Usp34 UTSW 11 23,331,337 (GRCm39) missense probably damaging 0.99
R9566:Usp34 UTSW 11 23,317,529 (GRCm39) missense
R9629:Usp34 UTSW 11 23,314,364 (GRCm39) missense
R9679:Usp34 UTSW 11 23,394,369 (GRCm39) missense
R9680:Usp34 UTSW 11 23,317,385 (GRCm39) missense possibly damaging 0.94
R9686:Usp34 UTSW 11 23,424,351 (GRCm39) missense
R9752:Usp34 UTSW 11 23,409,182 (GRCm39) missense probably benign 0.11
X0023:Usp34 UTSW 11 23,325,028 (GRCm39) missense possibly damaging 0.73
X0057:Usp34 UTSW 11 23,407,824 (GRCm39) missense possibly damaging 0.86
Z1176:Usp34 UTSW 11 23,423,221 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCTTGCCTAGTAGTGCAAGTCC -3'
(R):5'- ACTCTTTACAGTCGTCAAACCTGCC -3'

Sequencing Primer
(F):5'- GCCTAGTAGTGCAAGTCCTTAATG -3'
(R):5'- GTCAAACCTGCCATTGTTAGACTG -3'
Posted On 2014-04-24