Mutagenetix > Incidental Mutations

Incidental Mutation 'R1629:Gbp2b'

172663

Institutional Source

Beutler Lab

Gene Symbol

Gbp2b

Ensembl Gene

ENSMUSG00000040264

Gene Name

guanylate binding protein 2b

Synonyms

Gbp1, Mpa1, Mag-1, Gbp-1, Mpa-1

MMRRC Submission

039666-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1629 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

142594847-142619179 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 142610974 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 462 (Y462C)

Ref Sequence

ENSEMBL: ENSMUSP00000029936 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029936]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029936
AA Change: Y462C

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000029936
Gene: ENSMUSG00000040264
AA Change: Y462C

Domain	Start	End	E-Value	Type
Pfam:GBP	18	280	4.1e-122	PFAM
Pfam:GBP_C	282	578	5.5e-125	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.9%
20x: 91.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the guanylate-binding protein (GBP) family. GBPs specifically bind guanine nucleotides (GMP, GDP, and GTP) and contain two of the three consensus motifs found in typical GTP-binding proteins. The encoded protein interacts with a member of the germinal center kinase family. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a targeted allele exhibit increased susceptibility to bacterial infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts19	A	C	18: 58,954,619	I574L	probably damaging	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
BC005624	T	C	2: 30,974,008	E191G	probably damaging	Het
Cbx2	A	G	11: 119,028,980	D457G	probably damaging	Het
Ccdc110	A	G	8: 45,942,127	K352E	probably benign	Het
Cdk14	A	T	5: 5,103,807	H183Q	probably benign	Het
Cfap58	A	G	19: 47,941,339	T80A	probably benign	Het
Cftr	C	T	6: 18,226,106	T351I	probably damaging	Het
Col27a1	A	G	4: 63,329,863		probably benign	Het
Cp	T	A	3: 19,966,450		probably null	Het
Cpne8	A	T	15: 90,571,972	V196E	probably benign	Het
Dmxl1	T	G	18: 49,859,286		probably null	Het
Dnm2	T	A	9: 21,504,458	L642Q	probably damaging	Het
Dock2	G	T	11: 34,262,480		probably null	Het
Dock9	A	G	14: 121,543,574	F2091L	possibly damaging	Het
Eaf2	A	G	16: 36,824,701	V53A	probably damaging	Het
Fam208b	T	C	13: 3,574,121	H1943R	possibly damaging	Het
Fbl	G	T	7: 28,174,787		probably benign	Het
Fbn2	T	C	18: 58,026,538	D2373G	probably damaging	Het
Il1rl2	T	A	1: 40,356,860	F348I	probably benign	Het
Khdc1a	T	A	1: 21,350,897	I102N	possibly damaging	Het
Klhl11	T	C	11: 100,464,186	T270A	probably benign	Het
Lama1	T	C	17: 67,805,428	S2288P	probably benign	Het
Lrfn4	T	C	19: 4,613,495	E337G	possibly damaging	Het
Macf1	C	A	4: 123,508,415	E549*	probably null	Het
Mmp3	G	T	9: 7,447,641	V209F	probably benign	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Myh9	G	A	15: 77,764,401	R1725W	probably damaging	Het
Nbea	A	T	3: 56,002,891	D1294E	possibly damaging	Het
Nrcam	G	A	12: 44,563,986	A496T	probably benign	Het
Nufip2	A	G	11: 77,693,008	T583A	probably benign	Het
Olfr1033	A	G	2: 86,041,422	T36A	probably damaging	Het
Ppig	C	A	2: 69,735,873	T128K	probably damaging	Het
Ppp2r2a	A	T	14: 67,019,759	C341S	possibly damaging	Het
Ptpre	A	T	7: 135,669,799	D374V	probably damaging	Het
Ranbp3l	A	C	15: 9,064,988	Q485P	probably damaging	Het
Rapgef6	TG	TGG	11: 54,546,397		probably null	Het
Slc1a7	A	G	4: 108,008,143	Y276C	probably damaging	Het
Smarcad1	A	G	6: 65,067,107	D221G	probably benign	Het
Smn1	C	A	13: 100,127,896	T45N	probably damaging	Het
Son	T	C	16: 91,657,622	S1086P	probably damaging	Het
Ssmem1	T	A	6: 30,512,492	Y45N	possibly damaging	Het
Tmem184c	A	C	8: 77,602,922	F170V	possibly damaging	Het
Tmem184c	A	T	8: 77,606,162		probably null	Het
Vmn1r59	C	T	7: 5,454,467	C98Y	probably damaging	Het
Vmn2r23	T	A	6: 123,713,427	S421T	probably benign	Het
Vmn2r98	T	C	17: 19,067,383	S493P	possibly damaging	Het

Other mutations in Gbp2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01637:Gbp2b	APN	3	142598312	missense	probably damaging	1.00
IGL01892:Gbp2b	APN	3	142603620	missense	probably benign	0.03
IGL01989:Gbp2b	APN	3	142611440	missense	probably benign	0.19
IGL02019:Gbp2b	APN	3	142606990	missense	possibly damaging	0.52
IGL02338:Gbp2b	APN	3	142604226	missense	probably benign	0.09
IGL02657:Gbp2b	APN	3	142604112	missense	probably damaging	1.00
IGL03148:Gbp2b	APN	3	142606881	missense	probably benign	0.00
FR4304:Gbp2b	UTSW	3	142603652	missense	probably benign	0.00
FR4340:Gbp2b	UTSW	3	142603652	missense	probably benign	0.00
FR4342:Gbp2b	UTSW	3	142603652	missense	probably benign	0.00
FR4589:Gbp2b	UTSW	3	142603652	missense	probably benign	0.00
R0329:Gbp2b	UTSW	3	142608176	missense	probably benign	0.01
R0345:Gbp2b	UTSW	3	142608183	missense	probably damaging	1.00
R0358:Gbp2b	UTSW	3	142606789	missense	probably damaging	1.00
R0732:Gbp2b	UTSW	3	142606978	missense	probably benign
R1163:Gbp2b	UTSW	3	142599096	missense	probably damaging	1.00
R1550:Gbp2b	UTSW	3	142606830	missense	probably damaging	0.99
R1886:Gbp2b	UTSW	3	142608302	missense	probably benign
R1887:Gbp2b	UTSW	3	142608302	missense	probably benign
R2188:Gbp2b	UTSW	3	142608279	missense	probably benign	0.44
R2261:Gbp2b	UTSW	3	142606735	missense	probably benign	0.00
R3977:Gbp2b	UTSW	3	142603709	missense	probably benign	0.02
R4718:Gbp2b	UTSW	3	142598995	missense	probably damaging	1.00
R4788:Gbp2b	UTSW	3	142611410	missense	probably benign	0.21
R4807:Gbp2b	UTSW	3	142598245	missense	probably benign	0.02
R5042:Gbp2b	UTSW	3	142611463	missense	probably benign	0.03
R5087:Gbp2b	UTSW	3	142598254	missense	probably damaging	1.00
R5114:Gbp2b	UTSW	3	142598185	missense	probably damaging	1.00
R5414:Gbp2b	UTSW	3	142599091	missense	probably damaging	1.00
R5567:Gbp2b	UTSW	3	142611365	missense	possibly damaging	0.75
R5625:Gbp2b	UTSW	3	142599045	missense	probably damaging	1.00
R5685:Gbp2b	UTSW	3	142608158	missense	probably benign
R6030:Gbp2b	UTSW	3	142603653	missense	probably benign	0.00
R6030:Gbp2b	UTSW	3	142603653	missense	probably benign	0.00
R6408:Gbp2b	UTSW	3	142618138	missense	probably benign	0.00
R6500:Gbp2b	UTSW	3	142611491	missense	probably benign	0.06
R6581:Gbp2b	UTSW	3	142608238	nonsense	probably null
R6582:Gbp2b	UTSW	3	142611040	missense	possibly damaging	0.53
R6847:Gbp2b	UTSW	3	142598179	missense	probably damaging	0.96
R6923:Gbp2b	UTSW	3	142600559	missense	probably benign	0.01
R7120:Gbp2b	UTSW	3	142606746	missense	probably benign	0.01
R7255:Gbp2b	UTSW	3	142608117	missense	probably damaging	1.00
R7454:Gbp2b	UTSW	3	142598159	missense	possibly damaging	0.75
R7643:Gbp2b	UTSW	3	142603609	missense	probably benign	0.07
R8039:Gbp2b	UTSW	3	142618164	missense	probably benign	0.02
R8312:Gbp2b	UTSW	3	142599051	missense	probably benign
R8312:Gbp2b	UTSW	3	142599054	missense	probably damaging	0.96
R8391:Gbp2b	UTSW	3	142604133	missense	probably damaging	1.00
R8418:Gbp2b	UTSW	3	142603705	missense	probably benign	0.01
R8721:Gbp2b	UTSW	3	142606944	missense	possibly damaging	0.93
R8842:Gbp2b	UTSW	3	142606815	missense	probably benign
R8849:Gbp2b	UTSW	3	142608152	missense	probably benign	0.00
R8874:Gbp2b	UTSW	3	142608279	missense	probably benign	0.03
R8896:Gbp2b	UTSW	3	142603566	missense	probably damaging	1.00
R8992:Gbp2b	UTSW	3	142610969	missense	probably benign	0.00
R9339:Gbp2b	UTSW	3	142611417	missense	probably benign	0.01
Z1177:Gbp2b	UTSW	3	142604316	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- AATGATTGGCTCTGGAAGGGGACC -3'
(R):5'- CAGCCACCATGAAGCTAAGAGTGAC -3'

Sequencing Primer
(F):5'- CTCTGGAAGGGGACCTCAAG -3'
(R):5'- CACCATGAAGCTAAGAGTGACATTTG -3'

Posted On

2014-04-24