Incidental Mutation 'R1629:Cdk14'
ID172667
Institutional Source Beutler Lab
Gene Symbol Cdk14
Ensembl Gene ENSMUSG00000028926
Gene Namecyclin-dependent kinase 14
SynonymsPftk1
MMRRC Submission 039666-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1629 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location4803391-5420312 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 5103807 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 183 (H183Q)
Ref Sequence ENSEMBL: ENSMUSP00000111111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030763] [ENSMUST00000115450] [ENSMUST00000115451] [ENSMUST00000115452]
Predicted Effect probably benign
Transcript: ENSMUST00000030763
AA Change: H229Q

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000030763
Gene: ENSMUSG00000028926
AA Change: H229Q

DomainStartEndE-ValueType
low complexity region 119 127 N/A INTRINSIC
S_TKc 135 419 3.63e-85 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115450
AA Change: H183Q

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000111110
Gene: ENSMUSG00000028926
AA Change: H183Q

DomainStartEndE-ValueType
low complexity region 73 81 N/A INTRINSIC
S_TKc 89 373 3.63e-85 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115451
AA Change: H183Q

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000111111
Gene: ENSMUSG00000028926
AA Change: H183Q

DomainStartEndE-ValueType
low complexity region 73 81 N/A INTRINSIC
S_TKc 89 373 3.63e-85 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115452
AA Change: H211Q

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000111112
Gene: ENSMUSG00000028926
AA Change: H211Q

DomainStartEndE-ValueType
low complexity region 101 109 N/A INTRINSIC
S_TKc 117 401 3.63e-85 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132390
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133465
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134867
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PFTK1 is a member of the CDC2 (MIM 116940)-related protein kinase family (Yang and Chen, 2001 [PubMed 11313143]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 A C 18: 58,954,619 I574L probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
BC005624 T C 2: 30,974,008 E191G probably damaging Het
Cbx2 A G 11: 119,028,980 D457G probably damaging Het
Ccdc110 A G 8: 45,942,127 K352E probably benign Het
Cfap58 A G 19: 47,941,339 T80A probably benign Het
Cftr C T 6: 18,226,106 T351I probably damaging Het
Col27a1 A G 4: 63,329,863 probably benign Het
Cp T A 3: 19,966,450 probably null Het
Cpne8 A T 15: 90,571,972 V196E probably benign Het
Dmxl1 T G 18: 49,859,286 probably null Het
Dnm2 T A 9: 21,504,458 L642Q probably damaging Het
Dock2 G T 11: 34,262,480 probably null Het
Dock9 A G 14: 121,543,574 F2091L possibly damaging Het
Eaf2 A G 16: 36,824,701 V53A probably damaging Het
Fam208b T C 13: 3,574,121 H1943R possibly damaging Het
Fbl G T 7: 28,174,787 probably benign Het
Fbn2 T C 18: 58,026,538 D2373G probably damaging Het
Gbp2b A G 3: 142,610,974 Y462C possibly damaging Het
Il1rl2 T A 1: 40,356,860 F348I probably benign Het
Khdc1a T A 1: 21,350,897 I102N possibly damaging Het
Klhl11 T C 11: 100,464,186 T270A probably benign Het
Lama1 T C 17: 67,805,428 S2288P probably benign Het
Lrfn4 T C 19: 4,613,495 E337G possibly damaging Het
Macf1 C A 4: 123,508,415 E549* probably null Het
Mmp3 G T 9: 7,447,641 V209F probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myh9 G A 15: 77,764,401 R1725W probably damaging Het
Nbea A T 3: 56,002,891 D1294E possibly damaging Het
Nrcam G A 12: 44,563,986 A496T probably benign Het
Nufip2 A G 11: 77,693,008 T583A probably benign Het
Olfr1033 A G 2: 86,041,422 T36A probably damaging Het
Ppig C A 2: 69,735,873 T128K probably damaging Het
Ppp2r2a A T 14: 67,019,759 C341S possibly damaging Het
Ptpre A T 7: 135,669,799 D374V probably damaging Het
Ranbp3l A C 15: 9,064,988 Q485P probably damaging Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Slc1a7 A G 4: 108,008,143 Y276C probably damaging Het
Smarcad1 A G 6: 65,067,107 D221G probably benign Het
Smn1 C A 13: 100,127,896 T45N probably damaging Het
Son T C 16: 91,657,622 S1086P probably damaging Het
Ssmem1 T A 6: 30,512,492 Y45N possibly damaging Het
Tmem184c A C 8: 77,602,922 F170V possibly damaging Het
Tmem184c A T 8: 77,606,162 probably null Het
Vmn1r59 C T 7: 5,454,467 C98Y probably damaging Het
Vmn2r23 T A 6: 123,713,427 S421T probably benign Het
Vmn2r98 T C 17: 19,067,383 S493P possibly damaging Het
Other mutations in Cdk14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00678:Cdk14 APN 5 5249237 splice site probably benign
IGL01376:Cdk14 APN 5 5010839 missense probably damaging 1.00
IGL02102:Cdk14 APN 5 5380083 missense probably benign 0.01
IGL02179:Cdk14 APN 5 5103845 missense probably damaging 1.00
IGL02423:Cdk14 APN 5 4888905 missense probably benign 0.00
IGL03081:Cdk14 APN 5 4949527 splice site probably benign
IGL02988:Cdk14 UTSW 5 5036484 missense probably damaging 1.00
R0465:Cdk14 UTSW 5 5093019 missense probably damaging 1.00
R0630:Cdk14 UTSW 5 5135422 splice site probably benign
R1452:Cdk14 UTSW 5 4888927 missense possibly damaging 0.85
R1601:Cdk14 UTSW 5 5135378 missense probably damaging 1.00
R1659:Cdk14 UTSW 5 4949571 missense probably benign 0.08
R1809:Cdk14 UTSW 5 5010901 missense probably damaging 0.98
R2013:Cdk14 UTSW 5 5093047 missense probably damaging 1.00
R2015:Cdk14 UTSW 5 5380082 missense probably benign
R2256:Cdk14 UTSW 5 4888924 missense probably benign
R2257:Cdk14 UTSW 5 4888924 missense probably benign
R2908:Cdk14 UTSW 5 5249051 missense probably benign 0.33
R4324:Cdk14 UTSW 5 5036532 nonsense probably null
R4432:Cdk14 UTSW 5 5036427 missense probably damaging 1.00
R4907:Cdk14 UTSW 5 5249140 missense probably damaging 0.96
R5426:Cdk14 UTSW 5 4888975 missense possibly damaging 0.93
R5708:Cdk14 UTSW 5 5266036 intron probably benign
R6006:Cdk14 UTSW 5 5249211 start codon destroyed probably null 0.33
R6120:Cdk14 UTSW 5 4894029 missense probably damaging 0.96
R7048:Cdk14 UTSW 5 5093005 missense probably damaging 1.00
R7104:Cdk14 UTSW 5 5195325 missense possibly damaging 0.92
R7712:Cdk14 UTSW 5 5380061 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- GGAAACTCTGAGGTACAGCAGGAATCT -3'
(R):5'- GTGGGGCATGAAACTGCATACTCTAAA -3'

Sequencing Primer
(F):5'- GGATAGGATAACCCCTCTGAATG -3'
(R):5'- TCATCATGCTATAGCCAGAGGG -3'
Posted On2014-04-24