Incidental Mutation 'R1629:Alkbh2'
ID172668
Institutional Source Beutler Lab
Gene Symbol Alkbh2
Ensembl Gene ENSMUSG00000044339
Gene NamealkB homolog 2, alpha-ketoglutarate-dependent dioxygenase
SynonymsAbh2, mABH2
MMRRC Submission 039666-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1629 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location114123926-114128218 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 114124226 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 148 (E148K)
Ref Sequence ENSEMBL: ENSMUSP00000107898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031588] [ENSMUST00000053657] [ENSMUST00000112279] [ENSMUST00000149418] [ENSMUST00000200119]
Predicted Effect probably benign
Transcript: ENSMUST00000031588
SMART Domains Protein: ENSMUSP00000031588
Gene: ENSMUSG00000029592

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
transmembrane domain 35 57 N/A INTRINSIC
Pfam:UCH 67 499 2.6e-44 PFAM
Pfam:UCH_1 68 481 8.8e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000053657
AA Change: E148K

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000056043
Gene: ENSMUSG00000044339
AA Change: E148K

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
Pfam:2OG-FeII_Oxy_2 47 232 1.9e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112279
AA Change: E148K

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107898
Gene: ENSMUSG00000044339
AA Change: E148K

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
Pfam:2OG-FeII_Oxy_2 47 232 5.4e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149418
Predicted Effect probably benign
Transcript: ENSMUST00000200119
SMART Domains Protein: ENSMUSP00000142350
Gene: ENSMUSG00000029592

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
transmembrane domain 35 57 N/A INTRINSIC
Pfam:UCH 67 368 2.9e-31 PFAM
Pfam:UCH_1 68 376 1e-14 PFAM
Meta Mutation Damage Score 0.2232 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Escherichia coli AlkB protein protects against the cytotoxicity of methylating agents by repair of the specific DNA lesions generated in single-stranded DNA. ALKBH2 and ALKBH3 (MIM 610603) are E. coli AlkB homologs that catalyze the removal of 1-methyladenine and 3-methylcytosine (Duncan et al., 2002 [PubMed 12486230]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous null mice are viable and overtly normal but show progressive accumulation of 1-methyladenine (1meA) in their genomic DNA due to impaired DNA repair. Mutant MEFs fail to remove methyl methane sulfate (MMS)-induced 1meA from genomic DNA and showincreased cytotoxicity after MMS exposure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 A C 18: 58,954,619 I574L probably damaging Het
BC005624 T C 2: 30,974,008 E191G probably damaging Het
Cbx2 A G 11: 119,028,980 D457G probably damaging Het
Ccdc110 A G 8: 45,942,127 K352E probably benign Het
Cdk14 A T 5: 5,103,807 H183Q probably benign Het
Cfap58 A G 19: 47,941,339 T80A probably benign Het
Cftr C T 6: 18,226,106 T351I probably damaging Het
Col27a1 A G 4: 63,329,863 probably benign Het
Cp T A 3: 19,966,450 probably null Het
Cpne8 A T 15: 90,571,972 V196E probably benign Het
Dmxl1 T G 18: 49,859,286 probably null Het
Dnm2 T A 9: 21,504,458 L642Q probably damaging Het
Dock2 G T 11: 34,262,480 probably null Het
Dock9 A G 14: 121,543,574 F2091L possibly damaging Het
Eaf2 A G 16: 36,824,701 V53A probably damaging Het
Fam208b T C 13: 3,574,121 H1943R possibly damaging Het
Fbl G T 7: 28,174,787 probably benign Het
Fbn2 T C 18: 58,026,538 D2373G probably damaging Het
Gbp2b A G 3: 142,610,974 Y462C possibly damaging Het
Il1rl2 T A 1: 40,356,860 F348I probably benign Het
Khdc1a T A 1: 21,350,897 I102N possibly damaging Het
Klhl11 T C 11: 100,464,186 T270A probably benign Het
Lama1 T C 17: 67,805,428 S2288P probably benign Het
Lrfn4 T C 19: 4,613,495 E337G possibly damaging Het
Macf1 C A 4: 123,508,415 E549* probably null Het
Mmp3 G T 9: 7,447,641 V209F probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myh9 G A 15: 77,764,401 R1725W probably damaging Het
Nbea A T 3: 56,002,891 D1294E possibly damaging Het
Nrcam G A 12: 44,563,986 A496T probably benign Het
Nufip2 A G 11: 77,693,008 T583A probably benign Het
Olfr1033 A G 2: 86,041,422 T36A probably damaging Het
Ppig C A 2: 69,735,873 T128K probably damaging Het
Ppp2r2a A T 14: 67,019,759 C341S possibly damaging Het
Ptpre A T 7: 135,669,799 D374V probably damaging Het
Ranbp3l A C 15: 9,064,988 Q485P probably damaging Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Slc1a7 A G 4: 108,008,143 Y276C probably damaging Het
Smarcad1 A G 6: 65,067,107 D221G probably benign Het
Smn1 C A 13: 100,127,896 T45N probably damaging Het
Son T C 16: 91,657,622 S1086P probably damaging Het
Ssmem1 T A 6: 30,512,492 Y45N possibly damaging Het
Tmem184c A C 8: 77,602,922 F170V possibly damaging Het
Tmem184c A T 8: 77,606,162 probably null Het
Vmn1r59 C T 7: 5,454,467 C98Y probably damaging Het
Vmn2r23 T A 6: 123,713,427 S421T probably benign Het
Vmn2r98 T C 17: 19,067,383 S493P possibly damaging Het
Other mutations in Alkbh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02298:Alkbh2 APN 5 114125572 missense probably benign
R0326:Alkbh2 UTSW 5 114123950 makesense probably null
R0480:Alkbh2 UTSW 5 114125535 missense probably damaging 1.00
R0962:Alkbh2 UTSW 5 114123953 missense possibly damaging 0.94
R1214:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1215:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1280:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1282:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1309:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1340:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1371:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1443:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1445:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1545:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1546:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1631:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1632:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1707:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1769:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1920:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1921:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1922:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R1984:Alkbh2 UTSW 5 114124054 missense probably benign 0.12
R2140:Alkbh2 UTSW 5 114125716 missense probably benign 0.03
R2142:Alkbh2 UTSW 5 114125716 missense probably benign 0.03
R3800:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R3981:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4032:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4062:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4064:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4163:Alkbh2 UTSW 5 114127552 missense probably damaging 1.00
R4569:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4570:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4624:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4625:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4626:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4627:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4628:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4630:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4632:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4633:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4801:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4802:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
R4803:Alkbh2 UTSW 5 114124226 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCATCATCAGCAGGCTTCCGTG -3'
(R):5'- CTGTGAACCTGGAAGGCGTAGC -3'

Sequencing Primer
(F):5'- AGGCTTCCGTGTGCCAG -3'
(R):5'- acacagacagacagacagac -3'
Posted On2014-04-24