Incidental Mutation 'R1629:Smarcad1'
ID 172671
Institutional Source Beutler Lab
Gene Symbol Smarcad1
Ensembl Gene ENSMUSG00000029920
Gene Name SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1
Synonyms D6Pas1, Etl1
MMRRC Submission 039666-MU
Accession Numbers

Genbank: NM_007958; MGI: 95453

Essential gene? Possibly non essential (E-score: 0.407) question?
Stock # R1629 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 65042583-65116061 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 65067107 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 221 (D221G)
Ref Sequence ENSEMBL: ENSMUSP00000031984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031984] [ENSMUST00000204620]
AlphaFold Q04692
Predicted Effect probably benign
Transcript: ENSMUST00000031984
AA Change: D221G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000031984
Gene: ENSMUSG00000029920
AA Change: D221G

DomainStartEndE-ValueType
low complexity region 17 37 N/A INTRINSIC
low complexity region 39 53 N/A INTRINSIC
low complexity region 143 156 N/A INTRINSIC
low complexity region 210 224 N/A INTRINSIC
low complexity region 233 244 N/A INTRINSIC
low complexity region 333 348 N/A INTRINSIC
DEXDc 488 682 2.58e-38 SMART
Blast:DEXDc 685 745 4e-16 BLAST
HELICc 879 962 4.58e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203756
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204420
Predicted Effect probably benign
Transcript: ENSMUST00000204620
SMART Domains Protein: ENSMUSP00000144767
Gene: ENSMUSG00000029920

DomainStartEndE-ValueType
low complexity region 17 37 N/A INTRINSIC
low complexity region 39 53 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205092
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SNF subfamily of helicase proteins. The encoded protein plays a critical role in the restoration of heterochromatin organization and propagation of epigenetic patterns following DNA replication by mediating histone H3/H4 deacetylation. Mutations in this gene are associated with adermatoglyphia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit retarded growth, impaired fertility, skeletal dysplasias, and peri- and postnatal lethality. Mutant phenotypes are influenced by genetic background. [provided by MGI curators]
Allele List at MGI

All alleles(258) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(256)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 A C 18: 58,954,619 I574L probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
BC005624 T C 2: 30,974,008 E191G probably damaging Het
Cbx2 A G 11: 119,028,980 D457G probably damaging Het
Ccdc110 A G 8: 45,942,127 K352E probably benign Het
Cdk14 A T 5: 5,103,807 H183Q probably benign Het
Cfap58 A G 19: 47,941,339 T80A probably benign Het
Cftr C T 6: 18,226,106 T351I probably damaging Het
Col27a1 A G 4: 63,329,863 probably benign Het
Cp T A 3: 19,966,450 probably null Het
Cpne8 A T 15: 90,571,972 V196E probably benign Het
Dmxl1 T G 18: 49,859,286 probably null Het
Dnm2 T A 9: 21,504,458 L642Q probably damaging Het
Dock2 G T 11: 34,262,480 probably null Het
Dock9 A G 14: 121,543,574 F2091L possibly damaging Het
Eaf2 A G 16: 36,824,701 V53A probably damaging Het
Fam208b T C 13: 3,574,121 H1943R possibly damaging Het
Fbl G T 7: 28,174,787 probably benign Het
Fbn2 T C 18: 58,026,538 D2373G probably damaging Het
Gbp2b A G 3: 142,610,974 Y462C possibly damaging Het
Il1rl2 T A 1: 40,356,860 F348I probably benign Het
Khdc1a T A 1: 21,350,897 I102N possibly damaging Het
Klhl11 T C 11: 100,464,186 T270A probably benign Het
Lama1 T C 17: 67,805,428 S2288P probably benign Het
Lrfn4 T C 19: 4,613,495 E337G possibly damaging Het
Macf1 C A 4: 123,508,415 E549* probably null Het
Mmp3 G T 9: 7,447,641 V209F probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myh9 G A 15: 77,764,401 R1725W probably damaging Het
Nbea A T 3: 56,002,891 D1294E possibly damaging Het
Nrcam G A 12: 44,563,986 A496T probably benign Het
Nufip2 A G 11: 77,693,008 T583A probably benign Het
Olfr1033 A G 2: 86,041,422 T36A probably damaging Het
Ppig C A 2: 69,735,873 T128K probably damaging Het
Ppp2r2a A T 14: 67,019,759 C341S possibly damaging Het
Ptpre A T 7: 135,669,799 D374V probably damaging Het
Ranbp3l A C 15: 9,064,988 Q485P probably damaging Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Slc1a7 A G 4: 108,008,143 Y276C probably damaging Het
Smn1 C A 13: 100,127,896 T45N probably damaging Het
Son T C 16: 91,657,622 S1086P probably damaging Het
Ssmem1 T A 6: 30,512,492 Y45N possibly damaging Het
Tmem184c A C 8: 77,602,922 F170V possibly damaging Het
Tmem184c A T 8: 77,606,162 probably null Het
Vmn1r59 C T 7: 5,454,467 C98Y probably damaging Het
Vmn2r23 T A 6: 123,713,427 S421T probably benign Het
Vmn2r98 T C 17: 19,067,383 S493P possibly damaging Het
Other mutations in Smarcad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02318:Smarcad1 APN 6 65073239 missense probably damaging 1.00
IGL02707:Smarcad1 APN 6 65052806 unclassified probably benign
IGL03006:Smarcad1 APN 6 65083889 missense probably benign 0.01
IGL03131:Smarcad1 APN 6 65074953 missense probably damaging 0.96
IGL03406:Smarcad1 APN 6 65092526 missense probably damaging 0.98
Trollip UTSW 6 65114336 missense probably damaging 1.00
wastrel UTSW 6 65052670 missense probably damaging 1.00
N/A - 293:Smarcad1 UTSW 6 65074914 missense probably benign 0.06
R0020:Smarcad1 UTSW 6 65084007 splice site probably benign
R0452:Smarcad1 UTSW 6 65074822 missense possibly damaging 0.66
R1005:Smarcad1 UTSW 6 65108727 missense probably benign 0.30
R1143:Smarcad1 UTSW 6 65096694 missense probably benign 0.02
R1624:Smarcad1 UTSW 6 65052647 missense probably benign 0.40
R1705:Smarcad1 UTSW 6 65056416 missense probably damaging 1.00
R2000:Smarcad1 UTSW 6 65073216 missense probably damaging 1.00
R2979:Smarcad1 UTSW 6 65075011 missense probably benign 0.00
R3937:Smarcad1 UTSW 6 65114336 missense probably damaging 1.00
R4391:Smarcad1 UTSW 6 65056459 missense probably benign 0.17
R4648:Smarcad1 UTSW 6 65067089 missense probably benign 0.04
R4697:Smarcad1 UTSW 6 65052641 missense probably benign 0.00
R4709:Smarcad1 UTSW 6 65075115 missense probably benign 0.01
R4726:Smarcad1 UTSW 6 65075041 missense probably damaging 1.00
R4776:Smarcad1 UTSW 6 65098824 missense probably null 1.00
R4928:Smarcad1 UTSW 6 65074914 missense probably benign 0.06
R5619:Smarcad1 UTSW 6 65111881 missense probably benign 0.03
R5709:Smarcad1 UTSW 6 65074762 missense probably benign 0.01
R6038:Smarcad1 UTSW 6 65073248 missense possibly damaging 0.91
R6038:Smarcad1 UTSW 6 65073248 missense possibly damaging 0.91
R6220:Smarcad1 UTSW 6 65114329 missense probably benign 0.09
R6302:Smarcad1 UTSW 6 65075138 missense possibly damaging 0.93
R7014:Smarcad1 UTSW 6 65052670 missense probably damaging 1.00
R7149:Smarcad1 UTSW 6 65052732 missense probably benign 0.11
R7378:Smarcad1 UTSW 6 65110376 missense probably benign 0.16
R7569:Smarcad1 UTSW 6 65052711 missense probably benign 0.11
R7626:Smarcad1 UTSW 6 65096049 missense possibly damaging 0.71
R7774:Smarcad1 UTSW 6 65107830 missense probably damaging 1.00
R8079:Smarcad1 UTSW 6 65052782 missense possibly damaging 0.51
R8119:Smarcad1 UTSW 6 65094319 missense probably benign
R8129:Smarcad1 UTSW 6 65067094 missense probably benign 0.09
R8558:Smarcad1 UTSW 6 65083924 missense probably benign 0.09
R8679:Smarcad1 UTSW 6 65111881 missense probably benign 0.03
R8770:Smarcad1 UTSW 6 65052734 missense probably benign
R8795:Smarcad1 UTSW 6 65072049 missense probably benign 0.10
R9104:Smarcad1 UTSW 6 65098665 missense probably benign 0.06
R9133:Smarcad1 UTSW 6 65072051 missense probably damaging 0.99
R9400:Smarcad1 UTSW 6 65073230 missense probably damaging 0.97
R9401:Smarcad1 UTSW 6 65094337 missense probably benign 0.00
R9608:Smarcad1 UTSW 6 65114334 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCAGCTATATCCATGCAATACACC -3'
(R):5'- GGTCTGACATCCAAACATTCAGCACAG -3'

Sequencing Primer
(F):5'- GCTATATCCATGCAATACACCTTTAC -3'
(R):5'- gcctactgaagccagaagac -3'
Posted On 2014-04-24