Mutagenetix > Incidental Mutation

Incidental Mutation 'R1629:Smarcad1'

172671

Institutional Source

Beutler Lab

Gene Symbol

Smarcad1

Ensembl Gene

ENSMUSG00000029920

Gene Name

SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1

Synonyms

D6Pas1, Etl1

MMRRC Submission

039666-MU

Accession Numbers

Genbank: NM_007958; MGI: 95453

Essential gene?

Possibly non essential (E-score: 0.407) question?

Stock #

R1629 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

65042583-65116061 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 65067107 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 221 (D221G)

Ref Sequence

ENSEMBL: ENSMUSP00000031984 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031984] [ENSMUST00000204620]

AlphaFold

Q04692

Predicted Effect

probably benign
Transcript: ENSMUST00000031984
AA Change: D221G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000031984
Gene: ENSMUSG00000029920
AA Change: D221G

Domain	Start	End	E-Value	Type
low complexity region	17	37	N/A	INTRINSIC
low complexity region	39	53	N/A	INTRINSIC
low complexity region	143	156	N/A	INTRINSIC
low complexity region	210	224	N/A	INTRINSIC
low complexity region	233	244	N/A	INTRINSIC
low complexity region	333	348	N/A	INTRINSIC
DEXDc	488	682	2.58e-38	SMART
Blast:DEXDc	685	745	4e-16	BLAST
HELICc	879	962	4.58e-21	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203756

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000204420

Predicted Effect

probably benign
Transcript: ENSMUST00000204620

SMART Domains

Protein: ENSMUSP00000144767
Gene: ENSMUSG00000029920

Domain	Start	End	E-Value	Type
low complexity region	17	37	N/A	INTRINSIC
low complexity region	39	53	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205092

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.9%
20x: 91.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SNF subfamily of helicase proteins. The encoded protein plays a critical role in the restoration of heterochromatin organization and propagation of epigenetic patterns following DNA replication by mediating histone H3/H4 deacetylation. Mutations in this gene are associated with adermatoglyphia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit retarded growth, impaired fertility, skeletal dysplasias, and peri- and postnatal lethality. Mutant phenotypes are influenced by genetic background. [provided by MGI curators]

Allele List at MGI

All alleles(258) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(256)

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts19	A	C	18: 58,954,619	I574L	probably damaging	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
BC005624	T	C	2: 30,974,008	E191G	probably damaging	Het
Cbx2	A	G	11: 119,028,980	D457G	probably damaging	Het
Ccdc110	A	G	8: 45,942,127	K352E	probably benign	Het
Cdk14	A	T	5: 5,103,807	H183Q	probably benign	Het
Cfap58	A	G	19: 47,941,339	T80A	probably benign	Het
Cftr	C	T	6: 18,226,106	T351I	probably damaging	Het
Col27a1	A	G	4: 63,329,863		probably benign	Het
Cp	T	A	3: 19,966,450		probably null	Het
Cpne8	A	T	15: 90,571,972	V196E	probably benign	Het
Dmxl1	T	G	18: 49,859,286		probably null	Het
Dnm2	T	A	9: 21,504,458	L642Q	probably damaging	Het
Dock2	G	T	11: 34,262,480		probably null	Het
Dock9	A	G	14: 121,543,574	F2091L	possibly damaging	Het
Eaf2	A	G	16: 36,824,701	V53A	probably damaging	Het
Fam208b	T	C	13: 3,574,121	H1943R	possibly damaging	Het
Fbl	G	T	7: 28,174,787		probably benign	Het
Fbn2	T	C	18: 58,026,538	D2373G	probably damaging	Het
Gbp2b	A	G	3: 142,610,974	Y462C	possibly damaging	Het
Il1rl2	T	A	1: 40,356,860	F348I	probably benign	Het
Khdc1a	T	A	1: 21,350,897	I102N	possibly damaging	Het
Klhl11	T	C	11: 100,464,186	T270A	probably benign	Het
Lama1	T	C	17: 67,805,428	S2288P	probably benign	Het
Lrfn4	T	C	19: 4,613,495	E337G	possibly damaging	Het
Macf1	C	A	4: 123,508,415	E549*	probably null	Het
Mmp3	G	T	9: 7,447,641	V209F	probably benign	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Myh9	G	A	15: 77,764,401	R1725W	probably damaging	Het
Nbea	A	T	3: 56,002,891	D1294E	possibly damaging	Het
Nrcam	G	A	12: 44,563,986	A496T	probably benign	Het
Nufip2	A	G	11: 77,693,008	T583A	probably benign	Het
Olfr1033	A	G	2: 86,041,422	T36A	probably damaging	Het
Ppig	C	A	2: 69,735,873	T128K	probably damaging	Het
Ppp2r2a	A	T	14: 67,019,759	C341S	possibly damaging	Het
Ptpre	A	T	7: 135,669,799	D374V	probably damaging	Het
Ranbp3l	A	C	15: 9,064,988	Q485P	probably damaging	Het
Rapgef6	TG	TGG	11: 54,546,397		probably null	Het
Slc1a7	A	G	4: 108,008,143	Y276C	probably damaging	Het
Smn1	C	A	13: 100,127,896	T45N	probably damaging	Het
Son	T	C	16: 91,657,622	S1086P	probably damaging	Het
Ssmem1	T	A	6: 30,512,492	Y45N	possibly damaging	Het
Tmem184c	A	C	8: 77,602,922	F170V	possibly damaging	Het
Tmem184c	A	T	8: 77,606,162		probably null	Het
Vmn1r59	C	T	7: 5,454,467	C98Y	probably damaging	Het
Vmn2r23	T	A	6: 123,713,427	S421T	probably benign	Het
Vmn2r98	T	C	17: 19,067,383	S493P	possibly damaging	Het

Other mutations in Smarcad1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02318:Smarcad1	APN	6	65073239	missense	probably damaging	1.00
IGL02707:Smarcad1	APN	6	65052806	unclassified	probably benign
IGL03006:Smarcad1	APN	6	65083889	missense	probably benign	0.01
IGL03131:Smarcad1	APN	6	65074953	missense	probably damaging	0.96
IGL03406:Smarcad1	APN	6	65092526	missense	probably damaging	0.98
Trollip	UTSW	6	65114336	missense	probably damaging	1.00
wastrel	UTSW	6	65052670	missense	probably damaging	1.00
N/A - 293:Smarcad1	UTSW	6	65074914	missense	probably benign	0.06
R0020:Smarcad1	UTSW	6	65084007	splice site	probably benign
R0452:Smarcad1	UTSW	6	65074822	missense	possibly damaging	0.66
R1005:Smarcad1	UTSW	6	65108727	missense	probably benign	0.30
R1143:Smarcad1	UTSW	6	65096694	missense	probably benign	0.02
R1624:Smarcad1	UTSW	6	65052647	missense	probably benign	0.40
R1705:Smarcad1	UTSW	6	65056416	missense	probably damaging	1.00
R2000:Smarcad1	UTSW	6	65073216	missense	probably damaging	1.00
R2979:Smarcad1	UTSW	6	65075011	missense	probably benign	0.00
R3937:Smarcad1	UTSW	6	65114336	missense	probably damaging	1.00
R4391:Smarcad1	UTSW	6	65056459	missense	probably benign	0.17
R4648:Smarcad1	UTSW	6	65067089	missense	probably benign	0.04
R4697:Smarcad1	UTSW	6	65052641	missense	probably benign	0.00
R4709:Smarcad1	UTSW	6	65075115	missense	probably benign	0.01
R4726:Smarcad1	UTSW	6	65075041	missense	probably damaging	1.00
R4776:Smarcad1	UTSW	6	65098824	missense	probably null	1.00
R4928:Smarcad1	UTSW	6	65074914	missense	probably benign	0.06
R5619:Smarcad1	UTSW	6	65111881	missense	probably benign	0.03
R5709:Smarcad1	UTSW	6	65074762	missense	probably benign	0.01
R6038:Smarcad1	UTSW	6	65073248	missense	possibly damaging	0.91
R6038:Smarcad1	UTSW	6	65073248	missense	possibly damaging	0.91
R6220:Smarcad1	UTSW	6	65114329	missense	probably benign	0.09
R6302:Smarcad1	UTSW	6	65075138	missense	possibly damaging	0.93
R7014:Smarcad1	UTSW	6	65052670	missense	probably damaging	1.00
R7149:Smarcad1	UTSW	6	65052732	missense	probably benign	0.11
R7378:Smarcad1	UTSW	6	65110376	missense	probably benign	0.16
R7569:Smarcad1	UTSW	6	65052711	missense	probably benign	0.11
R7626:Smarcad1	UTSW	6	65096049	missense	possibly damaging	0.71
R7774:Smarcad1	UTSW	6	65107830	missense	probably damaging	1.00
R8079:Smarcad1	UTSW	6	65052782	missense	possibly damaging	0.51
R8119:Smarcad1	UTSW	6	65094319	missense	probably benign
R8129:Smarcad1	UTSW	6	65067094	missense	probably benign	0.09
R8558:Smarcad1	UTSW	6	65083924	missense	probably benign	0.09
R8679:Smarcad1	UTSW	6	65111881	missense	probably benign	0.03
R8770:Smarcad1	UTSW	6	65052734	missense	probably benign
R8795:Smarcad1	UTSW	6	65072049	missense	probably benign	0.10
R9104:Smarcad1	UTSW	6	65098665	missense	probably benign	0.06
R9133:Smarcad1	UTSW	6	65072051	missense	probably damaging	0.99
R9400:Smarcad1	UTSW	6	65073230	missense	probably damaging	0.97
R9401:Smarcad1	UTSW	6	65094337	missense	probably benign	0.00
R9608:Smarcad1	UTSW	6	65114334	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGCAGCTATATCCATGCAATACACC -3'
(R):5'- GGTCTGACATCCAAACATTCAGCACAG -3'

Sequencing Primer
(F):5'- GCTATATCCATGCAATACACCTTTAC -3'
(R):5'- gcctactgaagccagaagac -3'

Posted On

2014-04-24