Incidental Mutation 'R1629:Fbl'
ID172675
Institutional Source Beutler Lab
Gene Symbol Fbl
Ensembl Gene ENSMUSG00000046865
Gene Namefibrillarin
SynonymsRNU3IP1
MMRRC Submission 039666-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1629 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location28169710-28179269 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to T at 28174787 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042405] [ENSMUST00000085901] [ENSMUST00000172761] [ENSMUST00000208967]
Predicted Effect unknown
Transcript: ENSMUST00000042405
AA Change: G66W
SMART Domains Protein: ENSMUSP00000037613
Gene: ENSMUSG00000046865
AA Change: G66W

DomainStartEndE-ValueType
low complexity region 8 85 N/A INTRINSIC
Fibrillarin 94 321 9.92e-176 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000085901
SMART Domains Protein: ENSMUSP00000083064
Gene: ENSMUSG00000002409

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 22 41 N/A INTRINSIC
S_TKc 111 431 3.75e-78 SMART
low complexity region 438 454 N/A INTRINSIC
low complexity region 460 477 N/A INTRINSIC
low complexity region 542 561 N/A INTRINSIC
low complexity region 571 591 N/A INTRINSIC
low complexity region 597 615 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172761
SMART Domains Protein: ENSMUSP00000133719
Gene: ENSMUSG00000002409

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 22 41 N/A INTRINSIC
S_TKc 111 391 1.52e-78 SMART
low complexity region 398 414 N/A INTRINSIC
low complexity region 420 437 N/A INTRINSIC
low complexity region 502 521 N/A INTRINSIC
low complexity region 531 551 N/A INTRINSIC
low complexity region 557 575 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207384
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207397
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207956
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208259
Predicted Effect probably benign
Transcript: ENSMUST00000208967
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a component of a nucleolar small nuclear ribonucleoprotein (snRNP) particle thought to participate in the first step in processing preribosomal RNA. It is associated with the U3, U8, and U13 small nuclear RNAs and is located in the dense fibrillar component (DFC) of the nucleolus. The encoded protein contains an N-terminal repetitive domain that is rich in glycine and arginine residues, like fibrillarins in other species. Its central region resembles an RNA-binding domain and contains an RNP consensus sequence. Antisera from approximately 8% of humans with the autoimmune disease scleroderma recognize fibrillarin. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality with morula arrest. Heterozygous null mice display partial embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 A C 18: 58,954,619 I574L probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
BC005624 T C 2: 30,974,008 E191G probably damaging Het
Cbx2 A G 11: 119,028,980 D457G probably damaging Het
Ccdc110 A G 8: 45,942,127 K352E probably benign Het
Cdk14 A T 5: 5,103,807 H183Q probably benign Het
Cfap58 A G 19: 47,941,339 T80A probably benign Het
Cftr C T 6: 18,226,106 T351I probably damaging Het
Col27a1 A G 4: 63,329,863 probably benign Het
Cp T A 3: 19,966,450 probably null Het
Cpne8 A T 15: 90,571,972 V196E probably benign Het
Dmxl1 T G 18: 49,859,286 probably null Het
Dnm2 T A 9: 21,504,458 L642Q probably damaging Het
Dock2 G T 11: 34,262,480 probably null Het
Dock9 A G 14: 121,543,574 F2091L possibly damaging Het
Eaf2 A G 16: 36,824,701 V53A probably damaging Het
Fam208b T C 13: 3,574,121 H1943R possibly damaging Het
Fbn2 T C 18: 58,026,538 D2373G probably damaging Het
Gbp2b A G 3: 142,610,974 Y462C possibly damaging Het
Il1rl2 T A 1: 40,356,860 F348I probably benign Het
Khdc1a T A 1: 21,350,897 I102N possibly damaging Het
Klhl11 T C 11: 100,464,186 T270A probably benign Het
Lama1 T C 17: 67,805,428 S2288P probably benign Het
Lrfn4 T C 19: 4,613,495 E337G possibly damaging Het
Macf1 C A 4: 123,508,415 E549* probably null Het
Mmp3 G T 9: 7,447,641 V209F probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myh9 G A 15: 77,764,401 R1725W probably damaging Het
Nbea A T 3: 56,002,891 D1294E possibly damaging Het
Nrcam G A 12: 44,563,986 A496T probably benign Het
Nufip2 A G 11: 77,693,008 T583A probably benign Het
Olfr1033 A G 2: 86,041,422 T36A probably damaging Het
Ppig C A 2: 69,735,873 T128K probably damaging Het
Ppp2r2a A T 14: 67,019,759 C341S possibly damaging Het
Ptpre A T 7: 135,669,799 D374V probably damaging Het
Ranbp3l A C 15: 9,064,988 Q485P probably damaging Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Slc1a7 A G 4: 108,008,143 Y276C probably damaging Het
Smarcad1 A G 6: 65,067,107 D221G probably benign Het
Smn1 C A 13: 100,127,896 T45N probably damaging Het
Son T C 16: 91,657,622 S1086P probably damaging Het
Ssmem1 T A 6: 30,512,492 Y45N possibly damaging Het
Tmem184c A C 8: 77,602,922 F170V possibly damaging Het
Tmem184c A T 8: 77,606,162 probably null Het
Vmn1r59 C T 7: 5,454,467 C98Y probably damaging Het
Vmn2r23 T A 6: 123,713,427 S421T probably benign Het
Vmn2r98 T C 17: 19,067,383 S493P possibly damaging Het
Other mutations in Fbl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02641:Fbl APN 7 28175046 missense probably damaging 1.00
R3859:Fbl UTSW 7 28174510 unclassified probably benign
R5367:Fbl UTSW 7 28175050 missense probably damaging 1.00
R5618:Fbl UTSW 7 28178986 missense probably damaging 1.00
R6207:Fbl UTSW 7 28174853 missense possibly damaging 0.86
R7344:Fbl UTSW 7 28178935 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGCCTGTGCCTTGCTGATTTC -3'
(R):5'- CCTCCTTTCCGCGACAGATAAAGAC -3'

Sequencing Primer
(F):5'- agaggaggtggaagaggag -3'
(R):5'- GCGACAGATAAAGACACCTGG -3'
Posted On2014-04-24