Incidental Mutation 'R1629:Tmem184c'
ID172680
Institutional Source Beutler Lab
Gene Symbol Tmem184c
Ensembl Gene ENSMUSG00000031617
Gene Nametransmembrane protein 184C
SynonymsTmem34, 8430433H16Rik
MMRRC Submission 039666-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.205) question?
Stock #R1629 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location77595982-77610698 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 77606162 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034030] [ENSMUST00000034030] [ENSMUST00000141202] [ENSMUST00000152168] [ENSMUST00000152168]
Predicted Effect probably null
Transcript: ENSMUST00000034030
SMART Domains Protein: ENSMUSP00000034030
Gene: ENSMUSG00000031617

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Solute_trans_a 48 317 1.9e-101 PFAM
low complexity region 373 388 N/A INTRINSIC
low complexity region 404 415 N/A INTRINSIC
internal_repeat_1 422 485 1.18e-11 PROSPERO
low complexity region 500 512 N/A INTRINSIC
internal_repeat_1 519 599 1.18e-11 PROSPERO
low complexity region 600 621 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000034030
SMART Domains Protein: ENSMUSP00000034030
Gene: ENSMUSG00000031617

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Solute_trans_a 48 317 1.9e-101 PFAM
low complexity region 373 388 N/A INTRINSIC
low complexity region 404 415 N/A INTRINSIC
internal_repeat_1 422 485 1.18e-11 PROSPERO
low complexity region 500 512 N/A INTRINSIC
internal_repeat_1 519 599 1.18e-11 PROSPERO
low complexity region 600 621 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139140
Predicted Effect probably benign
Transcript: ENSMUST00000141202
SMART Domains Protein: ENSMUSP00000120041
Gene: ENSMUSG00000031617

DomainStartEndE-ValueType
transmembrane domain 54 76 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000152168
SMART Domains Protein: ENSMUSP00000114463
Gene: ENSMUSG00000031617

DomainStartEndE-ValueType
transmembrane domain 53 75 N/A INTRINSIC
Pfam:Solute_trans_a 85 228 1.4e-49 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000152168
SMART Domains Protein: ENSMUSP00000114463
Gene: ENSMUSG00000031617

DomainStartEndE-ValueType
transmembrane domain 53 75 N/A INTRINSIC
Pfam:Solute_trans_a 85 228 1.4e-49 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 A C 18: 58,954,619 I574L probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
BC005624 T C 2: 30,974,008 E191G probably damaging Het
Cbx2 A G 11: 119,028,980 D457G probably damaging Het
Ccdc110 A G 8: 45,942,127 K352E probably benign Het
Cdk14 A T 5: 5,103,807 H183Q probably benign Het
Cfap58 A G 19: 47,941,339 T80A probably benign Het
Cftr C T 6: 18,226,106 T351I probably damaging Het
Col27a1 A G 4: 63,329,863 probably benign Het
Cp T A 3: 19,966,450 probably null Het
Cpne8 A T 15: 90,571,972 V196E probably benign Het
Dmxl1 T G 18: 49,859,286 probably null Het
Dnm2 T A 9: 21,504,458 L642Q probably damaging Het
Dock2 G T 11: 34,262,480 probably null Het
Dock9 A G 14: 121,543,574 F2091L possibly damaging Het
Eaf2 A G 16: 36,824,701 V53A probably damaging Het
Fam208b T C 13: 3,574,121 H1943R possibly damaging Het
Fbl G T 7: 28,174,787 probably benign Het
Fbn2 T C 18: 58,026,538 D2373G probably damaging Het
Gbp2b A G 3: 142,610,974 Y462C possibly damaging Het
Il1rl2 T A 1: 40,356,860 F348I probably benign Het
Khdc1a T A 1: 21,350,897 I102N possibly damaging Het
Klhl11 T C 11: 100,464,186 T270A probably benign Het
Lama1 T C 17: 67,805,428 S2288P probably benign Het
Lrfn4 T C 19: 4,613,495 E337G possibly damaging Het
Macf1 C A 4: 123,508,415 E549* probably null Het
Mmp3 G T 9: 7,447,641 V209F probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myh9 G A 15: 77,764,401 R1725W probably damaging Het
Nbea A T 3: 56,002,891 D1294E possibly damaging Het
Nrcam G A 12: 44,563,986 A496T probably benign Het
Nufip2 A G 11: 77,693,008 T583A probably benign Het
Olfr1033 A G 2: 86,041,422 T36A probably damaging Het
Ppig C A 2: 69,735,873 T128K probably damaging Het
Ppp2r2a A T 14: 67,019,759 C341S possibly damaging Het
Ptpre A T 7: 135,669,799 D374V probably damaging Het
Ranbp3l A C 15: 9,064,988 Q485P probably damaging Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Slc1a7 A G 4: 108,008,143 Y276C probably damaging Het
Smarcad1 A G 6: 65,067,107 D221G probably benign Het
Smn1 C A 13: 100,127,896 T45N probably damaging Het
Son T C 16: 91,657,622 S1086P probably damaging Het
Ssmem1 T A 6: 30,512,492 Y45N possibly damaging Het
Vmn1r59 C T 7: 5,454,467 C98Y probably damaging Het
Vmn2r23 T A 6: 123,713,427 S421T probably benign Het
Vmn2r98 T C 17: 19,067,383 S493P possibly damaging Het
Other mutations in Tmem184c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01894:Tmem184c APN 8 77597146 nonsense probably null
IGL02024:Tmem184c APN 8 77604814 missense probably benign 0.10
IGL02231:Tmem184c APN 8 77604812 missense probably damaging 1.00
IGL02736:Tmem184c APN 8 77597846 missense probably damaging 1.00
IGL02934:Tmem184c APN 8 77597820 missense probably damaging 1.00
IGL03046:Tmem184c UTSW 8 77599657 nonsense probably null
R0107:Tmem184c UTSW 8 77597073 missense possibly damaging 0.78
R0107:Tmem184c UTSW 8 77597073 missense possibly damaging 0.78
R0189:Tmem184c UTSW 8 77597812 missense possibly damaging 0.92
R0564:Tmem184c UTSW 8 77606160 unclassified probably null
R0946:Tmem184c UTSW 8 77604757 missense probably damaging 1.00
R1629:Tmem184c UTSW 8 77602922 missense possibly damaging 0.87
R2261:Tmem184c UTSW 8 77597043 missense probably damaging 1.00
R2261:Tmem184c UTSW 8 77597175 missense probably damaging 0.99
R2919:Tmem184c UTSW 8 77604647 missense probably damaging 1.00
R3805:Tmem184c UTSW 8 77596875 missense unknown
R5418:Tmem184c UTSW 8 77597820 missense probably damaging 1.00
R5716:Tmem184c UTSW 8 77606407 missense possibly damaging 0.90
R5934:Tmem184c UTSW 8 77604723 nonsense probably null
R5951:Tmem184c UTSW 8 77598662 splice site probably null
R6150:Tmem184c UTSW 8 77596440 missense probably benign 0.04
R7206:Tmem184c UTSW 8 77596577 missense possibly damaging 0.46
R7387:Tmem184c UTSW 8 77597930 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGCTGAACCCATGCTTCAGTTTCTG -3'
(R):5'- GCTGCTAACCATACCCGTGTCATTG -3'

Sequencing Primer
(F):5'- tcaggaggcagaggcag -3'
(R):5'- CATTGTGGGGAATCCTTCAAC -3'
Posted On2014-04-24