Incidental Mutation 'R1629:Dock2'
Institutional Source Beutler Lab
Gene Symbol Dock2
Ensembl Gene ENSMUSG00000020143
Gene Namededicator of cyto-kinesis 2
SynonymsCED-5, MBC, Hch
MMRRC Submission 039666-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1629 (G1)
Quality Score225
Status Not validated
Chromosomal Location34226815-34783892 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to T at 34262480 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000090884 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093193]
Predicted Effect probably null
Transcript: ENSMUST00000093193
SMART Domains Protein: ENSMUSP00000090884
Gene: ENSMUSG00000020143

SH3 11 68 1.22e-11 SMART
Pfam:DOCK_N 71 414 2e-113 PFAM
Pfam:DOCK-C2 419 616 1e-60 PFAM
Pfam:DHR-2 1114 1614 6.3e-96 PFAM
low complexity region 1691 1706 N/A INTRINSIC
low complexity region 1793 1800 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the CDM protein family. It is specifically expressed in hematopoietic cells and is predominantly expressed in peripheral blood leukocytes. The protein is involved in remodeling of the actin cytoskeleton required for lymphocyte migration in response to chemokine signaling. It activates members of the Rho family of GTPases, for example RAC1 and RAC2, by acting as a guanine nucleotide exchange factor (GEF) to exchange bound GDP for free GTP. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygous mutants are defective in the migration of T and B lympohcytes in response to chemokines, and thus display immune defects such as lymphocytopenia, atrophy of lymphoid follicles and loss of marginal-zone B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 A C 18: 58,954,619 I574L probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
BC005624 T C 2: 30,974,008 E191G probably damaging Het
Cbx2 A G 11: 119,028,980 D457G probably damaging Het
Ccdc110 A G 8: 45,942,127 K352E probably benign Het
Cdk14 A T 5: 5,103,807 H183Q probably benign Het
Cfap58 A G 19: 47,941,339 T80A probably benign Het
Cftr C T 6: 18,226,106 T351I probably damaging Het
Col27a1 A G 4: 63,329,863 probably benign Het
Cp T A 3: 19,966,450 probably null Het
Cpne8 A T 15: 90,571,972 V196E probably benign Het
Dmxl1 T G 18: 49,859,286 probably null Het
Dnm2 T A 9: 21,504,458 L642Q probably damaging Het
Dock9 A G 14: 121,543,574 F2091L possibly damaging Het
Eaf2 A G 16: 36,824,701 V53A probably damaging Het
Fam208b T C 13: 3,574,121 H1943R possibly damaging Het
Fbl G T 7: 28,174,787 probably benign Het
Fbn2 T C 18: 58,026,538 D2373G probably damaging Het
Gbp2b A G 3: 142,610,974 Y462C possibly damaging Het
Il1rl2 T A 1: 40,356,860 F348I probably benign Het
Khdc1a T A 1: 21,350,897 I102N possibly damaging Het
Klhl11 T C 11: 100,464,186 T270A probably benign Het
Lama1 T C 17: 67,805,428 S2288P probably benign Het
Lrfn4 T C 19: 4,613,495 E337G possibly damaging Het
Macf1 C A 4: 123,508,415 E549* probably null Het
Mmp3 G T 9: 7,447,641 V209F probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myh9 G A 15: 77,764,401 R1725W probably damaging Het
Nbea A T 3: 56,002,891 D1294E possibly damaging Het
Nrcam G A 12: 44,563,986 A496T probably benign Het
Nufip2 A G 11: 77,693,008 T583A probably benign Het
Olfr1033 A G 2: 86,041,422 T36A probably damaging Het
Ppig C A 2: 69,735,873 T128K probably damaging Het
Ppp2r2a A T 14: 67,019,759 C341S possibly damaging Het
Ptpre A T 7: 135,669,799 D374V probably damaging Het
Ranbp3l A C 15: 9,064,988 Q485P probably damaging Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Slc1a7 A G 4: 108,008,143 Y276C probably damaging Het
Smarcad1 A G 6: 65,067,107 D221G probably benign Het
Smn1 C A 13: 100,127,896 T45N probably damaging Het
Son T C 16: 91,657,622 S1086P probably damaging Het
Ssmem1 T A 6: 30,512,492 Y45N possibly damaging Het
Tmem184c A C 8: 77,602,922 F170V possibly damaging Het
Tmem184c A T 8: 77,606,162 probably null Het
Vmn1r59 C T 7: 5,454,467 C98Y probably damaging Het
Vmn2r23 T A 6: 123,713,427 S421T probably benign Het
Vmn2r98 T C 17: 19,067,383 S493P possibly damaging Het
Other mutations in Dock2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Dock2 APN 11 34704661 missense probably damaging 1.00
IGL00469:Dock2 APN 11 34229603 splice site probably benign
IGL01061:Dock2 APN 11 34705826 missense probably damaging 1.00
IGL01319:Dock2 APN 11 34698790 missense possibly damaging 0.61
IGL01451:Dock2 APN 11 34310390 missense probably damaging 1.00
IGL01490:Dock2 APN 11 34705781 missense probably damaging 0.97
IGL01601:Dock2 APN 11 34239528 critical splice donor site probably null
IGL01800:Dock2 APN 11 34756273 missense probably damaging 1.00
IGL01804:Dock2 APN 11 34262433 missense probably benign 0.01
IGL01823:Dock2 APN 11 34262391 missense probably damaging 1.00
IGL01829:Dock2 APN 11 34705841 missense probably damaging 0.98
IGL01830:Dock2 APN 11 34691917 nonsense probably null
IGL01835:Dock2 APN 11 34310435 missense possibly damaging 0.51
IGL01845:Dock2 APN 11 34708865 missense probably benign 0.02
IGL01953:Dock2 APN 11 34732356 missense probably benign 0.28
IGL01989:Dock2 APN 11 34268053 missense probably benign
IGL02081:Dock2 APN 11 34254355 missense probably benign
IGL02105:Dock2 APN 11 34714525 missense probably damaging 1.00
IGL02153:Dock2 APN 11 34230670 missense probably benign 0.01
IGL02170:Dock2 APN 11 34267949 missense probably damaging 1.00
IGL02344:Dock2 APN 11 34731510 missense probably damaging 0.98
IGL02389:Dock2 APN 11 34698740 splice site probably benign
IGL02409:Dock2 APN 11 34501204 missense probably benign 0.00
IGL02472:Dock2 APN 11 34249801 missense probably benign 0.00
IGL02625:Dock2 APN 11 34501168 critical splice donor site probably null
IGL02929:Dock2 APN 11 34268048 missense probably damaging 1.00
IGL02951:Dock2 APN 11 34310448 unclassified probably benign
IGL02999:Dock2 APN 11 34692259 missense probably damaging 0.99
IGL03165:Dock2 APN 11 34687533 missense probably damaging 0.99
Arches UTSW 11 34689760 missense probably damaging 1.00
capitol_reef UTSW 11 34294170 critical splice acceptor site probably null
Croesus UTSW 11 34721027 missense probably damaging 1.00
denali UTSW 11 34229472 critical splice donor site probably null
dew UTSW 11 34248636 nonsense probably null
Dry UTSW 11 34231652 missense possibly damaging 0.79
frazz UTSW 11 34248572 critical splice donor site probably benign
frizz UTSW 11 34258184 splice site probably benign
gildenstern UTSW 11 34732339 critical splice donor site probably null
godsgrace UTSW 11 34695453 missense probably damaging 1.00
Harborside UTSW 11 34262445 missense probably benign
Landing UTSW 11 34714501 missense possibly damaging 0.83
latest UTSW 11 34756222 missense probably damaging 1.00
Launch UTSW 11 34256562 missense probably damaging 1.00
liaoning UTSW 11 34708793 missense probably damaging 1.00
midas UTSW 11 34294323 missense probably damaging 0.99
muelle UTSW 11 34687538 missense probably damaging 1.00
narrowest UTSW 11 34282652 missense probably damaging 0.98
pier UTSW 11 34689766 missense probably damaging 1.00
Plank UTSW 11 34783795 missense possibly damaging 0.51
riches UTSW 11 34688452 critical splice donor site probably null
skiff UTSW 11 34262388 missense probably null 0.80
Slip UTSW 11 34294286 missense probably benign 0.25
toothskin UTSW 11 34464922 missense probably damaging 1.00
Touch UTSW 11 34273750 missense possibly damaging 0.95
wassup UTSW 11 34503413 missense probably damaging 1.00
Wharf UTSW 11 34732371 missense possibly damaging 0.81
BB009:Dock2 UTSW 11 34267998 missense probably benign 0.00
BB019:Dock2 UTSW 11 34267998 missense probably benign 0.00
IGL03052:Dock2 UTSW 11 34232853 missense probably benign 0.01
PIT4377001:Dock2 UTSW 11 34721008 missense probably benign 0.02
R0006:Dock2 UTSW 11 34312453 unclassified probably benign
R0012:Dock2 UTSW 11 34783795 missense possibly damaging 0.51
R0063:Dock2 UTSW 11 34756284 critical splice acceptor site probably null
R0063:Dock2 UTSW 11 34756284 critical splice acceptor site probably null
R0116:Dock2 UTSW 11 34688565 intron probably benign
R0149:Dock2 UTSW 11 34438327 missense probably damaging 1.00
R0361:Dock2 UTSW 11 34438327 missense probably damaging 1.00
R0462:Dock2 UTSW 11 34268052 missense possibly damaging 0.74
R0471:Dock2 UTSW 11 34688553 missense probably benign 0.30
R0538:Dock2 UTSW 11 34704718 splice site probably benign
R0543:Dock2 UTSW 11 34294325 missense probably damaging 1.00
R0660:Dock2 UTSW 11 34248621 missense probably damaging 1.00
R0676:Dock2 UTSW 11 34695236 missense probably damaging 0.99
R0722:Dock2 UTSW 11 34464970 splice site probably benign
R0801:Dock2 UTSW 11 34708793 missense probably damaging 1.00
R1110:Dock2 UTSW 11 34256535 missense possibly damaging 0.78
R1171:Dock2 UTSW 11 34695241 missense probably damaging 1.00
R1387:Dock2 UTSW 11 34273309 splice site probably benign
R1445:Dock2 UTSW 11 34239705 missense probably benign
R1494:Dock2 UTSW 11 34282761 nonsense probably null
R1589:Dock2 UTSW 11 34706461 missense probably damaging 0.99
R1597:Dock2 UTSW 11 34704647 missense probably benign 0.00
R1749:Dock2 UTSW 11 34232767 critical splice donor site probably null
R1888:Dock2 UTSW 11 34707342 missense probably damaging 1.00
R1888:Dock2 UTSW 11 34707342 missense probably damaging 1.00
R1899:Dock2 UTSW 11 34294286 missense probably benign 0.25
R1924:Dock2 UTSW 11 34464934 missense possibly damaging 0.69
R2031:Dock2 UTSW 11 34727470 splice site probably benign
R2045:Dock2 UTSW 11 34294106 splice site probably null
R2098:Dock2 UTSW 11 34266279 missense probably benign 0.16
R2098:Dock2 UTSW 11 34719005 missense probably damaging 0.99
R2129:Dock2 UTSW 11 34727415 missense probably damaging 1.00
R2147:Dock2 UTSW 11 34229472 critical splice donor site probably null
R2149:Dock2 UTSW 11 34229472 critical splice donor site probably null
R2150:Dock2 UTSW 11 34229472 critical splice donor site probably null
R2176:Dock2 UTSW 11 34695217 missense probably benign 0.00
R2230:Dock2 UTSW 11 34294323 missense probably damaging 0.99
R2508:Dock2 UTSW 11 34312485 missense probably benign 0.04
R2875:Dock2 UTSW 11 34718885 missense probably damaging 1.00
R2885:Dock2 UTSW 11 34689766 missense probably damaging 1.00
R2910:Dock2 UTSW 11 34232910 splice site probably benign
R3081:Dock2 UTSW 11 34231610 missense probably benign
R3418:Dock2 UTSW 11 34689760 missense probably damaging 1.00
R3552:Dock2 UTSW 11 34720960 missense probably benign 0.22
R3731:Dock2 UTSW 11 34708895 missense probably damaging 1.00
R3846:Dock2 UTSW 11 34732371 missense possibly damaging 0.81
R4135:Dock2 UTSW 11 34714501 missense possibly damaging 0.83
R4598:Dock2 UTSW 11 34239536 missense probably damaging 1.00
R4599:Dock2 UTSW 11 34239536 missense probably damaging 1.00
R4715:Dock2 UTSW 11 34294118 missense probably damaging 1.00
R4722:Dock2 UTSW 11 34695471 missense probably damaging 1.00
R4742:Dock2 UTSW 11 34294170 critical splice acceptor site probably null
R4830:Dock2 UTSW 11 34273767 splice site probably null
R4884:Dock2 UTSW 11 34266248 missense probably damaging 1.00
R4990:Dock2 UTSW 11 34695251 missense probably damaging 1.00
R5334:Dock2 UTSW 11 34228643 missense probably benign 0.00
R5570:Dock2 UTSW 11 34727406 missense probably damaging 1.00
R5602:Dock2 UTSW 11 34254391 missense probably benign 0.16
R5681:Dock2 UTSW 11 34249836 missense probably benign 0.06
R5809:Dock2 UTSW 11 34262445 missense probably benign
R5860:Dock2 UTSW 11 34256562 missense probably damaging 1.00
R6111:Dock2 UTSW 11 34708787 missense probably damaging 0.99
R6155:Dock2 UTSW 11 34294123 missense probably benign 0.06
R6156:Dock2 UTSW 11 34247789 missense possibly damaging 0.51
R6173:Dock2 UTSW 11 34262388 missense probably null 0.80
R6182:Dock2 UTSW 11 34229476 missense probably damaging 0.97
R6188:Dock2 UTSW 11 34503396 missense probably damaging 0.98
R6191:Dock2 UTSW 11 34231652 missense possibly damaging 0.79
R6283:Dock2 UTSW 11 34707325 missense probably damaging 0.99
R6395:Dock2 UTSW 11 34232874 missense probably damaging 1.00
R6465:Dock2 UTSW 11 34503413 missense probably damaging 1.00
R6500:Dock2 UTSW 11 34362822 missense possibly damaging 0.76
R6561:Dock2 UTSW 11 34687538 missense probably damaging 1.00
R6745:Dock2 UTSW 11 34705842 missense probably damaging 1.00
R6745:Dock2 UTSW 11 34705843 missense probably damaging 1.00
R6880:Dock2 UTSW 11 34688452 critical splice donor site probably null
R6913:Dock2 UTSW 11 34756222 missense probably damaging 1.00
R6997:Dock2 UTSW 11 34464922 missense probably damaging 1.00
R7057:Dock2 UTSW 11 34227684 missense probably benign 0.10
R7057:Dock2 UTSW 11 34695217 missense probably benign 0.00
R7134:Dock2 UTSW 11 34310363 missense probably benign 0.03
R7188:Dock2 UTSW 11 34239675 missense possibly damaging 0.87
R7239:Dock2 UTSW 11 34231677 missense probably benign 0.00
R7247:Dock2 UTSW 11 34714513 nonsense probably null
R7250:Dock2 UTSW 11 34695205 missense probably benign 0.01
R7250:Dock2 UTSW 11 34695293 missense probably damaging 1.00
R7271:Dock2 UTSW 11 34273750 missense possibly damaging 0.95
R7284:Dock2 UTSW 11 34230672 missense probably benign 0.01
R7397:Dock2 UTSW 11 34718989 missense probably benign 0.00
R7464:Dock2 UTSW 11 34695278 missense probably damaging 0.99
R7512:Dock2 UTSW 11 34312542 missense possibly damaging 0.95
R7556:Dock2 UTSW 11 34720951 missense probably benign 0.43
R7663:Dock2 UTSW 11 34721027 missense probably damaging 1.00
R7779:Dock2 UTSW 11 34714455 missense probably benign 0.38
R7797:Dock2 UTSW 11 34282652 missense probably damaging 0.98
R7855:Dock2 UTSW 11 34273698 missense probably damaging 1.00
R7922:Dock2 UTSW 11 34707327 missense probably benign 0.29
R7932:Dock2 UTSW 11 34267998 missense probably benign 0.00
R8013:Dock2 UTSW 11 34705850 missense probably damaging 0.96
R8192:Dock2 UTSW 11 34732339 critical splice donor site probably null
R8244:Dock2 UTSW 11 34695453 missense probably damaging 1.00
R8307:Dock2 UTSW 11 34310362 missense possibly damaging 0.95
R8418:Dock2 UTSW 11 34718968 missense probably benign 0.01
R8460:Dock2 UTSW 11 34230825 critical splice acceptor site probably null
R8495:Dock2 UTSW 11 34231622 missense probably benign 0.14
R8556:Dock2 UTSW 11 34262457 missense possibly damaging 0.84
R8690:Dock2 UTSW 11 34727460 nonsense probably null
R8743:Dock2 UTSW 11 34273252 nonsense probably null
R8757:Dock2 UTSW 11 34695240 missense probably benign 0.13
R8759:Dock2 UTSW 11 34695240 missense probably benign 0.13
R8793:Dock2 UTSW 11 34501215 missense probably benign 0.00
R8882:Dock2 UTSW 11 34704609 frame shift probably null
X0017:Dock2 UTSW 11 34266271 missense probably benign 0.08
X0018:Dock2 UTSW 11 34232833 missense possibly damaging 0.65
X0058:Dock2 UTSW 11 34256564 missense probably damaging 1.00
X0066:Dock2 UTSW 11 34310357 missense possibly damaging 0.95
Z1088:Dock2 UTSW 11 34438300 missense probably benign 0.14
Z1088:Dock2 UTSW 11 34692382 missense probably damaging 1.00
Z1088:Dock2 UTSW 11 34695212 nonsense probably null
Z1176:Dock2 UTSW 11 34718924 missense probably benign 0.04
Z1177:Dock2 UTSW 11 34312553 missense possibly damaging 0.68
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- ggcatcacttagcatacataacac -3'
Posted On2014-04-24