Incidental Mutation 'R1629:Rapgef6'
ID 172684
Institutional Source Beutler Lab
Gene Symbol Rapgef6
Ensembl Gene ENSMUSG00000037533
Gene Name Rap guanine nucleotide exchange factor (GEF) 6
Synonyms PDZ-GEF2, Pdzgef2, C030018K18Rik, RA-GEF-2
MMRRC Submission 039666-MU
Accession Numbers

Genbank: NM_175258; MGI: 2384761

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1629 (G1)
Quality Score 217
Status Not validated
Chromosome 11
Chromosomal Location 54522847-54699285 bp(+) (GRCm38)
Type of Mutation frame shift
DNA Base Change (assembly) TG to TGG at 54546397 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101206] [ENSMUST00000102743] [ENSMUST00000108895] [ENSMUST00000207429]
AlphaFold Q5NCJ1
Predicted Effect probably null
Transcript: ENSMUST00000101206
SMART Domains Protein: ENSMUSP00000098766
Gene: ENSMUSG00000037533

DomainStartEndE-ValueType
internal_repeat_1 10 82 1.45e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 525 4.35e-33 SMART
PDZ 540 612 8.86e-16 SMART
low complexity region 694 705 N/A INTRINSIC
RA 749 835 1.47e-20 SMART
RasGEF 856 1095 5.35e-87 SMART
low complexity region 1237 1250 N/A INTRINSIC
low complexity region 1270 1293 N/A INTRINSIC
low complexity region 1345 1364 N/A INTRINSIC
low complexity region 1368 1380 N/A INTRINSIC
low complexity region 1444 1452 N/A INTRINSIC
low complexity region 1555 1568 N/A INTRINSIC
low complexity region 1591 1604 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102743
SMART Domains Protein: ENSMUSP00000099804
Gene: ENSMUSG00000037533

DomainStartEndE-ValueType
internal_repeat_1 10 82 1.42e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 525 4.35e-33 SMART
PDZ 540 612 8.86e-16 SMART
low complexity region 694 705 N/A INTRINSIC
RA 749 835 1.47e-20 SMART
RasGEF 856 1138 3.88e-84 SMART
low complexity region 1229 1242 N/A INTRINSIC
low complexity region 1262 1285 N/A INTRINSIC
low complexity region 1337 1356 N/A INTRINSIC
low complexity region 1360 1372 N/A INTRINSIC
low complexity region 1436 1444 N/A INTRINSIC
low complexity region 1547 1560 N/A INTRINSIC
low complexity region 1583 1596 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108895
SMART Domains Protein: ENSMUSP00000104523
Gene: ENSMUSG00000037533

DomainStartEndE-ValueType
internal_repeat_1 10 82 1.95e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 526 1.03e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139360
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155132
Predicted Effect probably null
Transcript: ENSMUST00000207429
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit an inlarged spleen, increased IgE and IgG levels and altered cytokine production. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(13)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 A C 18: 58,954,619 I574L probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
BC005624 T C 2: 30,974,008 E191G probably damaging Het
Cbx2 A G 11: 119,028,980 D457G probably damaging Het
Ccdc110 A G 8: 45,942,127 K352E probably benign Het
Cdk14 A T 5: 5,103,807 H183Q probably benign Het
Cfap58 A G 19: 47,941,339 T80A probably benign Het
Cftr C T 6: 18,226,106 T351I probably damaging Het
Col27a1 A G 4: 63,329,863 probably benign Het
Cp T A 3: 19,966,450 probably null Het
Cpne8 A T 15: 90,571,972 V196E probably benign Het
Dmxl1 T G 18: 49,859,286 probably null Het
Dnm2 T A 9: 21,504,458 L642Q probably damaging Het
Dock2 G T 11: 34,262,480 probably null Het
Dock9 A G 14: 121,543,574 F2091L possibly damaging Het
Eaf2 A G 16: 36,824,701 V53A probably damaging Het
Fam208b T C 13: 3,574,121 H1943R possibly damaging Het
Fbl G T 7: 28,174,787 probably benign Het
Fbn2 T C 18: 58,026,538 D2373G probably damaging Het
Gbp2b A G 3: 142,610,974 Y462C possibly damaging Het
Il1rl2 T A 1: 40,356,860 F348I probably benign Het
Khdc1a T A 1: 21,350,897 I102N possibly damaging Het
Klhl11 T C 11: 100,464,186 T270A probably benign Het
Lama1 T C 17: 67,805,428 S2288P probably benign Het
Lrfn4 T C 19: 4,613,495 E337G possibly damaging Het
Macf1 C A 4: 123,508,415 E549* probably null Het
Mmp3 G T 9: 7,447,641 V209F probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myh9 G A 15: 77,764,401 R1725W probably damaging Het
Nbea A T 3: 56,002,891 D1294E possibly damaging Het
Nrcam G A 12: 44,563,986 A496T probably benign Het
Nufip2 A G 11: 77,693,008 T583A probably benign Het
Olfr1033 A G 2: 86,041,422 T36A probably damaging Het
Ppig C A 2: 69,735,873 T128K probably damaging Het
Ppp2r2a A T 14: 67,019,759 C341S possibly damaging Het
Ptpre A T 7: 135,669,799 D374V probably damaging Het
Ranbp3l A C 15: 9,064,988 Q485P probably damaging Het
Slc1a7 A G 4: 108,008,143 Y276C probably damaging Het
Smarcad1 A G 6: 65,067,107 D221G probably benign Het
Smn1 C A 13: 100,127,896 T45N probably damaging Het
Son T C 16: 91,657,622 S1086P probably damaging Het
Ssmem1 T A 6: 30,512,492 Y45N possibly damaging Het
Tmem184c A C 8: 77,602,922 F170V possibly damaging Het
Tmem184c A T 8: 77,606,162 probably null Het
Vmn1r59 C T 7: 5,454,467 C98Y probably damaging Het
Vmn2r23 T A 6: 123,713,427 S421T probably benign Het
Vmn2r98 T C 17: 19,067,383 S493P possibly damaging Het
Other mutations in Rapgef6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:Rapgef6 APN 11 54679265 missense probably benign 0.00
IGL00507:Rapgef6 APN 11 54664109 nonsense probably null
IGL00809:Rapgef6 APN 11 54649300 missense probably damaging 1.00
IGL00843:Rapgef6 APN 11 54691273 missense probably benign 0.03
IGL00899:Rapgef6 APN 11 54620018 nonsense probably null
IGL01372:Rapgef6 APN 11 54668611 splice site probably benign
IGL01604:Rapgef6 APN 11 54694563 missense probably damaging 0.99
IGL01935:Rapgef6 APN 11 54610842 missense possibly damaging 0.78
IGL01991:Rapgef6 APN 11 54552869 missense probably benign 0.37
IGL02243:Rapgef6 APN 11 54676400 missense probably damaging 1.00
IGL02407:Rapgef6 APN 11 54676355 missense possibly damaging 0.91
IGL02676:Rapgef6 APN 11 54649346 unclassified probably benign
IGL02934:Rapgef6 APN 11 54625864 missense probably damaging 1.00
IGL03076:Rapgef6 APN 11 54625967 missense probably damaging 1.00
IGL03110:Rapgef6 APN 11 54696089 missense probably damaging 0.97
IGL03256:Rapgef6 APN 11 54657429 missense probably damaging 1.00
shocker UTSW 11 54620016 missense probably damaging 1.00
D4216:Rapgef6 UTSW 11 54668746 splice site probably benign
PIT4305001:Rapgef6 UTSW 11 54679377 missense probably damaging 1.00
PIT4366001:Rapgef6 UTSW 11 54691620 missense probably damaging 0.98
R0047:Rapgef6 UTSW 11 54546378 missense possibly damaging 0.65
R0047:Rapgef6 UTSW 11 54546378 missense possibly damaging 0.65
R0125:Rapgef6 UTSW 11 54625875 nonsense probably null
R0189:Rapgef6 UTSW 11 54691249 missense probably benign
R0201:Rapgef6 UTSW 11 54619941 missense probably damaging 1.00
R0505:Rapgef6 UTSW 11 54625963 missense probably benign 0.00
R0524:Rapgef6 UTSW 11 54690284 missense probably benign 0.32
R0853:Rapgef6 UTSW 11 54668677 missense probably damaging 1.00
R1203:Rapgef6 UTSW 11 54691699 missense probably benign 0.09
R1440:Rapgef6 UTSW 11 54626708 missense probably damaging 1.00
R1453:Rapgef6 UTSW 11 54639727 splice site probably null
R1530:Rapgef6 UTSW 11 54661183 missense probably damaging 1.00
R1593:Rapgef6 UTSW 11 54546397 frame shift probably null
R1620:Rapgef6 UTSW 11 54626594 missense possibly damaging 0.88
R1628:Rapgef6 UTSW 11 54546397 frame shift probably null
R1630:Rapgef6 UTSW 11 54546397 frame shift probably null
R1634:Rapgef6 UTSW 11 54546397 frame shift probably null
R1640:Rapgef6 UTSW 11 54657405 missense probably damaging 1.00
R1686:Rapgef6 UTSW 11 54691632 missense possibly damaging 0.81
R1722:Rapgef6 UTSW 11 54546397 frame shift probably null
R1743:Rapgef6 UTSW 11 54676284 missense probably damaging 1.00
R1816:Rapgef6 UTSW 11 54694488 missense probably benign
R1851:Rapgef6 UTSW 11 54642811 missense probably benign 0.01
R1852:Rapgef6 UTSW 11 54642811 missense probably benign 0.01
R1868:Rapgef6 UTSW 11 54546397 frame shift probably null
R1888:Rapgef6 UTSW 11 54660828 missense probably damaging 1.00
R1888:Rapgef6 UTSW 11 54660828 missense probably damaging 1.00
R1942:Rapgef6 UTSW 11 54657263 missense possibly damaging 0.95
R1943:Rapgef6 UTSW 11 54657263 missense possibly damaging 0.95
R2031:Rapgef6 UTSW 11 54552858 missense probably benign 0.30
R2087:Rapgef6 UTSW 11 54631249 missense probably damaging 1.00
R2106:Rapgef6 UTSW 11 54668686 missense probably benign 0.17
R2362:Rapgef6 UTSW 11 54694272 missense probably damaging 1.00
R2484:Rapgef6 UTSW 11 54642756 missense possibly damaging 0.48
R2566:Rapgef6 UTSW 11 54687711 missense possibly damaging 0.66
R2872:Rapgef6 UTSW 11 54661175 missense probably damaging 1.00
R2872:Rapgef6 UTSW 11 54661175 missense probably damaging 1.00
R3744:Rapgef6 UTSW 11 54625934 missense probably benign 0.40
R3848:Rapgef6 UTSW 11 54691308 missense probably damaging 0.97
R4823:Rapgef6 UTSW 11 54694500 missense probably benign 0.08
R4859:Rapgef6 UTSW 11 54636163 missense probably benign
R4906:Rapgef6 UTSW 11 54552836 missense probably damaging 1.00
R4911:Rapgef6 UTSW 11 54622317 missense probably damaging 0.97
R4937:Rapgef6 UTSW 11 54657317 missense probably damaging 1.00
R5033:Rapgef6 UTSW 11 54691381 missense possibly damaging 0.92
R5249:Rapgef6 UTSW 11 54523117 missense probably benign 0.19
R5304:Rapgef6 UTSW 11 54657374 missense probably benign 0.01
R5656:Rapgef6 UTSW 11 54636136 missense possibly damaging 0.95
R5701:Rapgef6 UTSW 11 54676394 missense possibly damaging 0.76
R5758:Rapgef6 UTSW 11 54668644 missense probably damaging 1.00
R5973:Rapgef6 UTSW 11 54639783 missense probably damaging 1.00
R6177:Rapgef6 UTSW 11 54620016 missense probably damaging 1.00
R6268:Rapgef6 UTSW 11 54649247 missense probably damaging 1.00
R6287:Rapgef6 UTSW 11 54626338 splice site probably null
R6293:Rapgef6 UTSW 11 54634781 missense probably damaging 1.00
R6471:Rapgef6 UTSW 11 54691737 missense probably damaging 0.99
R6863:Rapgef6 UTSW 11 54546380 missense probably benign 0.00
R6950:Rapgef6 UTSW 11 54676380 missense probably benign 0.09
R7144:Rapgef6 UTSW 11 54657365 missense possibly damaging 0.78
R7171:Rapgef6 UTSW 11 54676363 missense possibly damaging 0.94
R7199:Rapgef6 UTSW 11 54546426 missense probably benign 0.00
R7291:Rapgef6 UTSW 11 54691239 missense probably benign 0.05
R7436:Rapgef6 UTSW 11 54610921 critical splice donor site probably null
R7498:Rapgef6 UTSW 11 54620004 missense probably damaging 1.00
R7506:Rapgef6 UTSW 11 54636171 missense probably benign 0.00
R7527:Rapgef6 UTSW 11 54634961 missense unknown
R7646:Rapgef6 UTSW 11 54625954 missense probably benign 0.00
R7655:Rapgef6 UTSW 11 54694453 missense probably benign 0.10
R7656:Rapgef6 UTSW 11 54694453 missense probably benign 0.10
R7687:Rapgef6 UTSW 11 54661075 missense possibly damaging 0.93
R7768:Rapgef6 UTSW 11 54626588 missense probably damaging 1.00
R7788:Rapgef6 UTSW 11 54694399 missense probably damaging 1.00
R7890:Rapgef6 UTSW 11 54626723 missense probably damaging 1.00
R8113:Rapgef6 UTSW 11 54625958 missense probably benign 0.03
R8337:Rapgef6 UTSW 11 54631301 nonsense probably null
R8393:Rapgef6 UTSW 11 54687661 missense probably benign
R8465:Rapgef6 UTSW 11 54691482 missense probably benign 0.00
R8492:Rapgef6 UTSW 11 54690237 missense probably damaging 0.99
R8791:Rapgef6 UTSW 11 54568469 missense probably benign 0.15
R8866:Rapgef6 UTSW 11 54552874 critical splice donor site probably null
R8917:Rapgef6 UTSW 11 54691566 nonsense probably null
R8921:Rapgef6 UTSW 11 54679239 missense probably benign 0.09
R9031:Rapgef6 UTSW 11 54687841 missense probably benign 0.00
R9093:Rapgef6 UTSW 11 54597086 nonsense probably null
R9354:Rapgef6 UTSW 11 54619923 missense possibly damaging 0.66
R9514:Rapgef6 UTSW 11 54552858 missense probably benign 0.14
R9516:Rapgef6 UTSW 11 54691343 missense probably damaging 1.00
R9739:Rapgef6 UTSW 11 54622363 missense probably benign 0.03
R9789:Rapgef6 UTSW 11 54649271 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CATATGACTGCCTCAGCCTCAATCC -3'
(R):5'- GGAAAGAAAGCCAGTGTCTTTAGCAAC -3'

Sequencing Primer
(F):5'- CAGGCATAGGCCACTATGACTG -3'
(R):5'- GCCAGTGTCTTTAGCAACAGTAG -3'
Posted On 2014-04-24