Mutagenetix > Incidental Mutations

Incidental Mutation 'R1629:Nrcam'

172688

Institutional Source

Beutler Lab

Gene Symbol

Nrcam

Ensembl Gene

ENSMUSG00000020598

Gene Name

neuronal cell adhesion molecule

Synonyms

C030017F07Rik, Bravo, C130076O07Rik

MMRRC Submission

039666-MU

Accession Numbers

Genbank: NM_176930.4, NM_001146031.1,

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1629 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

44328885-44601964 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 44563986 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 496 (A496T)

Ref Sequence

ENSEMBL: ENSMUSP00000151844 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020939] [ENSMUST00000110748] [ENSMUST00000220123]

Predicted Effect

probably benign
Transcript: ENSMUST00000020939
AA Change: A490T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000020939
Gene: ENSMUSG00000020598
AA Change: A490T

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
IGc2	53	124	5.37e-4	SMART
IG	146	233	3.91e-6	SMART
IGc2	277	341	1.73e-16	SMART
IGc2	367	433	4.85e-11	SMART
IGc2	461	526	4.92e-12	SMART
IGc2	552	617	6.55e-8	SMART
low complexity region	618	623	N/A	INTRINSIC
FN3	641	724	3.24e-10	SMART
FN3	738	824	1.77e-2	SMART
FN3	840	931	1.97e-9	SMART
FN3	946	1031	3.73e-10	SMART
transmembrane domain	1120	1142	N/A	INTRINSIC
Pfam:Bravo_FIGEY	1143	1232	2.9e-29	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000110748
AA Change: A490T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000106376
Gene: ENSMUSG00000020598
AA Change: A490T

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
IGc2	53	124	5.37e-4	SMART
IG	146	233	3.91e-6	SMART
IGc2	277	341	1.73e-16	SMART
IGc2	367	433	4.85e-11	SMART
IGc2	461	526	4.92e-12	SMART
IGc2	552	617	6.55e-8	SMART
FN3	631	714	3.24e-10	SMART
FN3	728	814	1.77e-2	SMART
FN3	830	921	1.97e-9	SMART
FN3	936	1021	3.73e-10	SMART
transmembrane domain	1050	1072	N/A	INTRINSIC
Pfam:Bravo_FIGEY	1073	1164	9.3e-35	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000219906

Predicted Effect

probably benign
Transcript: ENSMUST00000220123
AA Change: A496T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220130

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.9%
20x: 91.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cell adhesion molecules (CAMs) are members of the immunoglobulin superfamily. This gene encodes a neuronal cell adhesion molecule with multiple immunoglobulin-like C2-type domains and fibronectin type-III domains. This ankyrin-binding protein is involved in neuron-neuron adhesion and promotes directional signaling during axonal cone growth. This gene is also expressed in non-neural tissues and may play a general role in cell-cell communication via signaling from its intracellular domain to the actin cytoskeleton during directional cell migration. Allelic variants of this gene have been associated with autism and addiction vulnerability. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit disorganization of lens fibers, cellular disintegration, and accumulation of cellular debris resulting in cataracts. Mutants show mild reductions in cerebellar lobe size. [provided by MGI curators]

Allele List at MGI

All alleles(9) : Targeted, knock-out(2) Targeted, other(4) Gene trapped(2) Chemically induced(1)

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts19	A	C	18: 58,954,619	I574L	probably damaging	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
BC005624	T	C	2: 30,974,008	E191G	probably damaging	Het
Cbx2	A	G	11: 119,028,980	D457G	probably damaging	Het
Ccdc110	A	G	8: 45,942,127	K352E	probably benign	Het
Cdk14	A	T	5: 5,103,807	H183Q	probably benign	Het
Cfap58	A	G	19: 47,941,339	T80A	probably benign	Het
Cftr	C	T	6: 18,226,106	T351I	probably damaging	Het
Col27a1	A	G	4: 63,329,863		probably benign	Het
Cp	T	A	3: 19,966,450		probably null	Het
Cpne8	A	T	15: 90,571,972	V196E	probably benign	Het
Dmxl1	T	G	18: 49,859,286		probably null	Het
Dnm2	T	A	9: 21,504,458	L642Q	probably damaging	Het
Dock2	G	T	11: 34,262,480		probably null	Het
Dock9	A	G	14: 121,543,574	F2091L	possibly damaging	Het
Eaf2	A	G	16: 36,824,701	V53A	probably damaging	Het
Fam208b	T	C	13: 3,574,121	H1943R	possibly damaging	Het
Fbl	G	T	7: 28,174,787		probably benign	Het
Fbn2	T	C	18: 58,026,538	D2373G	probably damaging	Het
Gbp2b	A	G	3: 142,610,974	Y462C	possibly damaging	Het
Il1rl2	T	A	1: 40,356,860	F348I	probably benign	Het
Khdc1a	T	A	1: 21,350,897	I102N	possibly damaging	Het
Klhl11	T	C	11: 100,464,186	T270A	probably benign	Het
Lama1	T	C	17: 67,805,428	S2288P	probably benign	Het
Lrfn4	T	C	19: 4,613,495	E337G	possibly damaging	Het
Macf1	C	A	4: 123,508,415	E549*	probably null	Het
Mmp3	G	T	9: 7,447,641	V209F	probably benign	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Myh9	G	A	15: 77,764,401	R1725W	probably damaging	Het
Nbea	A	T	3: 56,002,891	D1294E	possibly damaging	Het
Nufip2	A	G	11: 77,693,008	T583A	probably benign	Het
Olfr1033	A	G	2: 86,041,422	T36A	probably damaging	Het
Ppig	C	A	2: 69,735,873	T128K	probably damaging	Het
Ppp2r2a	A	T	14: 67,019,759	C341S	possibly damaging	Het
Ptpre	A	T	7: 135,669,799	D374V	probably damaging	Het
Ranbp3l	A	C	15: 9,064,988	Q485P	probably damaging	Het
Rapgef6	TG	TGG	11: 54,546,397		probably null	Het
Slc1a7	A	G	4: 108,008,143	Y276C	probably damaging	Het
Smarcad1	A	G	6: 65,067,107	D221G	probably benign	Het
Smn1	C	A	13: 100,127,896	T45N	probably damaging	Het
Son	T	C	16: 91,657,622	S1086P	probably damaging	Het
Ssmem1	T	A	6: 30,512,492	Y45N	possibly damaging	Het
Tmem184c	A	C	8: 77,602,922	F170V	possibly damaging	Het
Tmem184c	A	T	8: 77,606,162		probably null	Het
Vmn1r59	C	T	7: 5,454,467	C98Y	probably damaging	Het
Vmn2r23	T	A	6: 123,713,427	S421T	probably benign	Het
Vmn2r98	T	C	17: 19,067,383	S493P	possibly damaging	Het

Other mutations in Nrcam

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01399:Nrcam	APN	12	44575884	missense	probably benign	0.27
IGL01657:Nrcam	APN	12	44559800	missense	probably damaging	1.00
IGL02434:Nrcam	APN	12	44590243	splice site	probably benign
IGL02455:Nrcam	APN	12	44570530	missense	probably damaging	1.00
IGL02712:Nrcam	APN	12	44573827	missense	probably damaging	1.00
IGL02834:Nrcam	APN	12	44541075	critical splice donor site	probably null
IGL03022:Nrcam	APN	12	44598442	missense	probably damaging	1.00
IGL03174:Nrcam	APN	12	44576006	splice site	probably benign
IGL03389:Nrcam	APN	12	44549906	missense	probably benign	0.00
IGL03397:Nrcam	APN	12	44559757	missense	probably damaging	1.00
I2288:Nrcam	UTSW	12	44564315	missense	probably benign	0.06
I2289:Nrcam	UTSW	12	44564315	missense	probably benign	0.06
R0063:Nrcam	UTSW	12	44550028	missense	possibly damaging	0.49
R0063:Nrcam	UTSW	12	44550028	missense	possibly damaging	0.49
R0195:Nrcam	UTSW	12	44584845	missense	probably benign	0.00
R0463:Nrcam	UTSW	12	44551341	missense	probably damaging	1.00
R0590:Nrcam	UTSW	12	44564032	missense	probably damaging	1.00
R0674:Nrcam	UTSW	12	44564322	missense	probably benign	0.17
R0930:Nrcam	UTSW	12	44549884	missense	probably benign
R1241:Nrcam	UTSW	12	44590164	missense	probably damaging	1.00
R1279:Nrcam	UTSW	12	44544877	unclassified	probably null
R1523:Nrcam	UTSW	12	44572249	missense	probably damaging	1.00
R1572:Nrcam	UTSW	12	44537364	splice site	probably benign
R1651:Nrcam	UTSW	12	44576679	missense	probably damaging	0.97
R1729:Nrcam	UTSW	12	44573850	missense	probably benign
R1739:Nrcam	UTSW	12	44571675	missense	probably damaging	1.00
R1803:Nrcam	UTSW	12	44572208	missense	probably benign
R1884:Nrcam	UTSW	12	44544755	missense	probably damaging	1.00
R1974:Nrcam	UTSW	12	44563993	missense	probably benign	0.05
R1992:Nrcam	UTSW	12	44540970	missense	probably damaging	1.00
R2102:Nrcam	UTSW	12	44576688	missense	probably benign	0.00
R2106:Nrcam	UTSW	12	44570290	missense	probably benign	0.12
R3854:Nrcam	UTSW	12	44575884	missense	probably benign	0.27
R4005:Nrcam	UTSW	12	44532646	missense	probably benign
R4088:Nrcam	UTSW	12	44572202	missense	possibly damaging	0.93
R4115:Nrcam	UTSW	12	44566326	missense	possibly damaging	0.87
R4428:Nrcam	UTSW	12	44576775	missense	possibly damaging	0.95
R4458:Nrcam	UTSW	12	44559730	missense	probably damaging	1.00
R4580:Nrcam	UTSW	12	44562540	critical splice donor site	probably null
R4601:Nrcam	UTSW	12	44591056	missense	probably damaging	1.00
R4688:Nrcam	UTSW	12	44547237	missense	probably benign
R4825:Nrcam	UTSW	12	44575986	nonsense	probably null
R4838:Nrcam	UTSW	12	44574019	missense	probably damaging	1.00
R4950:Nrcam	UTSW	12	44598490	missense	probably damaging	1.00
R4960:Nrcam	UTSW	12	44566299	missense	probably benign	0.01
R5081:Nrcam	UTSW	12	44570353	missense	probably benign	0.00
R5297:Nrcam	UTSW	12	44544784	missense	probably damaging	1.00
R5504:Nrcam	UTSW	12	44564132	critical splice donor site	probably null
R5593:Nrcam	UTSW	12	44559700	missense	probably damaging	1.00
R5654:Nrcam	UTSW	12	44564058	missense	probably benign
R5691:Nrcam	UTSW	12	44564256	missense	probably damaging	1.00
R5890:Nrcam	UTSW	12	44576771	missense	probably benign
R5937:Nrcam	UTSW	12	44572291	missense	probably benign	0.00
R5980:Nrcam	UTSW	12	44571633	missense	probably damaging	1.00
R6132:Nrcam	UTSW	12	44570224	missense	probably damaging	1.00
R6213:Nrcam	UTSW	12	44562432	missense	possibly damaging	0.90
R6334:Nrcam	UTSW	12	44572300	missense	probably benign
R6617:Nrcam	UTSW	12	44540963	missense	probably damaging	1.00
R6666:Nrcam	UTSW	12	44571555	missense	probably damaging	1.00
R7191:Nrcam	UTSW	12	44572244	missense	probably benign	0.01
R7284:Nrcam	UTSW	12	44564034	missense	probably damaging	1.00
R7326:Nrcam	UTSW	12	44564026	missense	possibly damaging	0.95
R7388:Nrcam	UTSW	12	44598489	missense	probably damaging	1.00
R7650:Nrcam	UTSW	12	44547322	missense	probably damaging	1.00
R7734:Nrcam	UTSW	12	44537251	missense	possibly damaging	0.49
R7840:Nrcam	UTSW	12	44541075	critical splice donor site	probably null
R7923:Nrcam	UTSW	12	44541075	critical splice donor site	probably null
U24488:Nrcam	UTSW	12	44537259	missense	probably damaging	1.00
X0057:Nrcam	UTSW	12	44551416	missense	probably benign
X0066:Nrcam	UTSW	12	44550029	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TTGACTGAGCATTTGTCGGTCCTAC -3'
(R):5'- GGCAAAGCTGGAGAATTTGTTCCAC -3'

Sequencing Primer
(F):5'- GCTTGTGGAAAACCCTTCAG -3'
(R):5'- GGAGAATTTGTTCCACGTCATATAG -3'

Posted On

2014-04-24