Incidental Mutation 'R1629:Fam208b'
ID172689
Institutional Source Beutler Lab
Gene Symbol Fam208b
Ensembl Gene ENSMUSG00000033799
Gene Namefamily with sequence similarity 208, member B
SynonymsBC016423
MMRRC Submission 039666-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R1629 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location3566035-3611108 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3574121 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 1943 (H1943R)
Ref Sequence ENSEMBL: ENSMUSP00000093774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096069]
Predicted Effect possibly damaging
Transcript: ENSMUST00000096069
AA Change: H1943R

PolyPhen 2 Score 0.838 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000093774
Gene: ENSMUSG00000033799
AA Change: H1943R

DomainStartEndE-ValueType
Pfam:DUF3699 91 167 1.4e-24 PFAM
low complexity region 272 282 N/A INTRINSIC
low complexity region 447 459 N/A INTRINSIC
Pfam:DUF3715 533 695 2.3e-25 PFAM
low complexity region 1156 1168 N/A INTRINSIC
low complexity region 1196 1207 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
low complexity region 2012 2021 N/A INTRINSIC
low complexity region 2250 2263 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221059
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222615
Predicted Effect unknown
Transcript: ENSMUST00000222909
AA Change: H1261R
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 A C 18: 58,954,619 I574L probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
BC005624 T C 2: 30,974,008 E191G probably damaging Het
Cbx2 A G 11: 119,028,980 D457G probably damaging Het
Ccdc110 A G 8: 45,942,127 K352E probably benign Het
Cdk14 A T 5: 5,103,807 H183Q probably benign Het
Cfap58 A G 19: 47,941,339 T80A probably benign Het
Cftr C T 6: 18,226,106 T351I probably damaging Het
Col27a1 A G 4: 63,329,863 probably benign Het
Cp T A 3: 19,966,450 probably null Het
Cpne8 A T 15: 90,571,972 V196E probably benign Het
Dmxl1 T G 18: 49,859,286 probably null Het
Dnm2 T A 9: 21,504,458 L642Q probably damaging Het
Dock2 G T 11: 34,262,480 probably null Het
Dock9 A G 14: 121,543,574 F2091L possibly damaging Het
Eaf2 A G 16: 36,824,701 V53A probably damaging Het
Fbl G T 7: 28,174,787 probably benign Het
Fbn2 T C 18: 58,026,538 D2373G probably damaging Het
Gbp2b A G 3: 142,610,974 Y462C possibly damaging Het
Il1rl2 T A 1: 40,356,860 F348I probably benign Het
Khdc1a T A 1: 21,350,897 I102N possibly damaging Het
Klhl11 T C 11: 100,464,186 T270A probably benign Het
Lama1 T C 17: 67,805,428 S2288P probably benign Het
Lrfn4 T C 19: 4,613,495 E337G possibly damaging Het
Macf1 C A 4: 123,508,415 E549* probably null Het
Mmp3 G T 9: 7,447,641 V209F probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myh9 G A 15: 77,764,401 R1725W probably damaging Het
Nbea A T 3: 56,002,891 D1294E possibly damaging Het
Nrcam G A 12: 44,563,986 A496T probably benign Het
Nufip2 A G 11: 77,693,008 T583A probably benign Het
Olfr1033 A G 2: 86,041,422 T36A probably damaging Het
Ppig C A 2: 69,735,873 T128K probably damaging Het
Ppp2r2a A T 14: 67,019,759 C341S possibly damaging Het
Ptpre A T 7: 135,669,799 D374V probably damaging Het
Ranbp3l A C 15: 9,064,988 Q485P probably damaging Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Slc1a7 A G 4: 108,008,143 Y276C probably damaging Het
Smarcad1 A G 6: 65,067,107 D221G probably benign Het
Smn1 C A 13: 100,127,896 T45N probably damaging Het
Son T C 16: 91,657,622 S1086P probably damaging Het
Ssmem1 T A 6: 30,512,492 Y45N possibly damaging Het
Tmem184c A C 8: 77,602,922 F170V possibly damaging Het
Tmem184c A T 8: 77,606,162 probably null Het
Vmn1r59 C T 7: 5,454,467 C98Y probably damaging Het
Vmn2r23 T A 6: 123,713,427 S421T probably benign Het
Vmn2r98 T C 17: 19,067,383 S493P possibly damaging Het
Other mutations in Fam208b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Fam208b APN 13 3574832 missense probably benign
IGL00670:Fam208b APN 13 3585241 missense probably benign 0.14
IGL00957:Fam208b APN 13 3577101 missense possibly damaging 0.86
IGL01311:Fam208b APN 13 3575885 missense possibly damaging 0.85
IGL01318:Fam208b APN 13 3575067 missense possibly damaging 0.66
IGL01767:Fam208b APN 13 3576633 missense probably benign 0.00
IGL02073:Fam208b APN 13 3574721 missense probably benign 0.01
IGL02152:Fam208b APN 13 3585371 missense probably benign
IGL02431:Fam208b APN 13 3574736 missense possibly damaging 0.85
IGL02478:Fam208b APN 13 3574661 missense probably benign 0.12
IGL02732:Fam208b APN 13 3573626 missense probably benign 0.09
IGL02745:Fam208b APN 13 3585140 missense probably benign 0.23
IGL02800:Fam208b APN 13 3585154 missense probably benign
IGL02989:Fam208b APN 13 3584820 missense probably benign 0.01
IGL03124:Fam208b APN 13 3574704 missense probably benign 0.41
IGL03154:Fam208b APN 13 3575255 missense possibly damaging 0.56
IGL03216:Fam208b APN 13 3574553 missense probably damaging 0.98
H8562:Fam208b UTSW 13 3577000 missense probably damaging 0.98
PIT4585001:Fam208b UTSW 13 3574979 missense possibly damaging 0.55
R0016:Fam208b UTSW 13 3585170 unclassified probably null
R0016:Fam208b UTSW 13 3585170 unclassified probably null
R0157:Fam208b UTSW 13 3575550 missense probably benign 0.06
R0375:Fam208b UTSW 13 3596842 missense possibly damaging 0.85
R0403:Fam208b UTSW 13 3582052 nonsense probably null
R0472:Fam208b UTSW 13 3588364 missense possibly damaging 0.93
R0517:Fam208b UTSW 13 3566964 missense possibly damaging 0.94
R0586:Fam208b UTSW 13 3590321 missense probably damaging 0.99
R0600:Fam208b UTSW 13 3576054 missense probably benign
R0659:Fam208b UTSW 13 3574448 missense probably damaging 0.99
R1257:Fam208b UTSW 13 3575049 missense probably benign 0.25
R1375:Fam208b UTSW 13 3576029 missense probably benign 0.06
R1443:Fam208b UTSW 13 3575543 missense probably benign 0.00
R1497:Fam208b UTSW 13 3570409 missense probably damaging 0.96
R1544:Fam208b UTSW 13 3590413 missense possibly damaging 0.68
R1554:Fam208b UTSW 13 3576374 missense possibly damaging 0.85
R1633:Fam208b UTSW 13 3581771 missense possibly damaging 0.53
R1661:Fam208b UTSW 13 3573860 missense possibly damaging 0.63
R1673:Fam208b UTSW 13 3584498 critical splice donor site probably null
R1675:Fam208b UTSW 13 3569507 missense possibly damaging 0.65
R1781:Fam208b UTSW 13 3584759 missense possibly damaging 0.95
R1792:Fam208b UTSW 13 3590559 missense possibly damaging 0.91
R1826:Fam208b UTSW 13 3581759 missense probably damaging 0.98
R1920:Fam208b UTSW 13 3576612 missense possibly damaging 0.63
R1983:Fam208b UTSW 13 3574853 missense possibly damaging 0.92
R2016:Fam208b UTSW 13 3576770 missense probably benign 0.41
R2017:Fam208b UTSW 13 3576770 missense probably benign 0.41
R2220:Fam208b UTSW 13 3581872 missense probably benign 0.00
R2513:Fam208b UTSW 13 3582150 missense possibly damaging 0.53
R2898:Fam208b UTSW 13 3585122 missense possibly damaging 0.82
R2904:Fam208b UTSW 13 3582185 missense possibly damaging 0.53
R3149:Fam208b UTSW 13 3574359 missense probably damaging 0.98
R3623:Fam208b UTSW 13 3595556 missense probably benign
R3624:Fam208b UTSW 13 3595556 missense probably benign
R3725:Fam208b UTSW 13 3590538 missense probably benign 0.33
R3835:Fam208b UTSW 13 3575292 missense probably benign 0.01
R3890:Fam208b UTSW 13 3596785 missense probably damaging 0.96
R4023:Fam208b UTSW 13 3584554 missense probably damaging 0.99
R4024:Fam208b UTSW 13 3584554 missense probably damaging 0.99
R4025:Fam208b UTSW 13 3584554 missense probably damaging 0.99
R4050:Fam208b UTSW 13 3573507 missense probably benign 0.09
R4308:Fam208b UTSW 13 3569498 missense probably damaging 0.97
R4484:Fam208b UTSW 13 3581831 missense probably benign 0.12
R4674:Fam208b UTSW 13 3573686 missense possibly damaging 0.69
R4718:Fam208b UTSW 13 3574495 missense probably benign 0.00
R4745:Fam208b UTSW 13 3590069 missense probably benign 0.26
R4776:Fam208b UTSW 13 3570391 missense probably damaging 1.00
R4839:Fam208b UTSW 13 3584807 missense probably damaging 0.96
R4855:Fam208b UTSW 13 3566680 splice site probably null
R5049:Fam208b UTSW 13 3574000 missense probably benign 0.00
R5076:Fam208b UTSW 13 3576357 missense probably benign 0.41
R5287:Fam208b UTSW 13 3575744 missense probably benign 0.41
R5298:Fam208b UTSW 13 3595613 splice site probably null
R5379:Fam208b UTSW 13 3588496 missense probably benign 0.41
R5512:Fam208b UTSW 13 3595517 missense probably damaging 0.99
R5624:Fam208b UTSW 13 3584996 missense possibly damaging 0.66
R5750:Fam208b UTSW 13 3573642 nonsense probably null
R6114:Fam208b UTSW 13 3590081 missense probably damaging 1.00
R6118:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6119:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6269:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6270:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6271:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6272:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6525:Fam208b UTSW 13 3576540 nonsense probably null
R6550:Fam208b UTSW 13 3590519 missense possibly damaging 0.85
R6714:Fam208b UTSW 13 3594189 missense probably benign 0.00
R6797:Fam208b UTSW 13 3576769 missense probably benign 0.26
R6967:Fam208b UTSW 13 3574819 missense probably benign 0.22
R7016:Fam208b UTSW 13 3576857 missense possibly damaging 0.92
R7219:Fam208b UTSW 13 3590521 missense probably damaging 0.99
R7454:Fam208b UTSW 13 3585332 missense probably benign 0.21
R7570:Fam208b UTSW 13 3573621 missense probably damaging 0.99
R7571:Fam208b UTSW 13 3575292 missense probably benign 0.01
X0024:Fam208b UTSW 13 3599837 missense probably null 0.99
X0025:Fam208b UTSW 13 3576827 missense probably benign 0.15
X0066:Fam208b UTSW 13 3588441 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CGTACAACTGTCACCAGAATGGGG -3'
(R):5'- ACAACAGTGATGACACCTGGGC -3'

Sequencing Primer
(F):5'- TTGGACGAGCGATTCCTTAG -3'
(R):5'- GGGCCTGTTCTAGCAAAATTTC -3'
Posted On2014-04-24