Incidental Mutation 'R1629:Smn1'
ID172691
Institutional Source Beutler Lab
Gene Symbol Smn1
Ensembl Gene ENSMUSG00000021645
Gene Namesurvival motor neuron 1
SynonymsSMN
MMRRC Submission 039666-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1629 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location100124852-100137690 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 100127896 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 45 (T45N)
Ref Sequence ENSEMBL: ENSMUSP00000119381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022147] [ENSMUST00000091321] [ENSMUST00000140745] [ENSMUST00000143937]
Predicted Effect probably damaging
Transcript: ENSMUST00000022147
AA Change: T119N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022147
Gene: ENSMUSG00000021645
AA Change: T119N

DomainStartEndE-ValueType
PDB:3S6N|M 23 59 3e-18 PDB
low complexity region 70 82 N/A INTRINSIC
TUDOR 87 146 7.06e-17 SMART
low complexity region 188 246 N/A INTRINSIC
PDB:4GLI|A 247 287 1e-13 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000091321
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125572
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134514
Predicted Effect probably benign
Transcript: ENSMUST00000140745
Predicted Effect probably damaging
Transcript: ENSMUST00000143937
AA Change: T45N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000119381
Gene: ENSMUSG00000021645
AA Change: T45N

DomainStartEndE-ValueType
TUDOR 13 72 6.15e-17 SMART
low complexity region 114 158 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147306
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151389
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations exhibit cell loss and peri-implantation lethality. Muscle-specific KO mice show muscle necrosis leading to paralysis and death. Neuron-specific KO mice show muscle degeneration associated with loss of motor axons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 A C 18: 58,954,619 I574L probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
BC005624 T C 2: 30,974,008 E191G probably damaging Het
Cbx2 A G 11: 119,028,980 D457G probably damaging Het
Ccdc110 A G 8: 45,942,127 K352E probably benign Het
Cdk14 A T 5: 5,103,807 H183Q probably benign Het
Cfap58 A G 19: 47,941,339 T80A probably benign Het
Cftr C T 6: 18,226,106 T351I probably damaging Het
Col27a1 A G 4: 63,329,863 probably benign Het
Cp T A 3: 19,966,450 probably null Het
Cpne8 A T 15: 90,571,972 V196E probably benign Het
Dmxl1 T G 18: 49,859,286 probably null Het
Dnm2 T A 9: 21,504,458 L642Q probably damaging Het
Dock2 G T 11: 34,262,480 probably null Het
Dock9 A G 14: 121,543,574 F2091L possibly damaging Het
Eaf2 A G 16: 36,824,701 V53A probably damaging Het
Fam208b T C 13: 3,574,121 H1943R possibly damaging Het
Fbl G T 7: 28,174,787 probably benign Het
Fbn2 T C 18: 58,026,538 D2373G probably damaging Het
Gbp2b A G 3: 142,610,974 Y462C possibly damaging Het
Il1rl2 T A 1: 40,356,860 F348I probably benign Het
Khdc1a T A 1: 21,350,897 I102N possibly damaging Het
Klhl11 T C 11: 100,464,186 T270A probably benign Het
Lama1 T C 17: 67,805,428 S2288P probably benign Het
Lrfn4 T C 19: 4,613,495 E337G possibly damaging Het
Macf1 C A 4: 123,508,415 E549* probably null Het
Mmp3 G T 9: 7,447,641 V209F probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myh9 G A 15: 77,764,401 R1725W probably damaging Het
Nbea A T 3: 56,002,891 D1294E possibly damaging Het
Nrcam G A 12: 44,563,986 A496T probably benign Het
Nufip2 A G 11: 77,693,008 T583A probably benign Het
Olfr1033 A G 2: 86,041,422 T36A probably damaging Het
Ppig C A 2: 69,735,873 T128K probably damaging Het
Ppp2r2a A T 14: 67,019,759 C341S possibly damaging Het
Ptpre A T 7: 135,669,799 D374V probably damaging Het
Ranbp3l A C 15: 9,064,988 Q485P probably damaging Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Slc1a7 A G 4: 108,008,143 Y276C probably damaging Het
Smarcad1 A G 6: 65,067,107 D221G probably benign Het
Son T C 16: 91,657,622 S1086P probably damaging Het
Ssmem1 T A 6: 30,512,492 Y45N possibly damaging Het
Tmem184c A C 8: 77,602,922 F170V possibly damaging Het
Tmem184c A T 8: 77,606,162 probably null Het
Vmn1r59 C T 7: 5,454,467 C98Y probably damaging Het
Vmn2r23 T A 6: 123,713,427 S421T probably benign Het
Vmn2r98 T C 17: 19,067,383 S493P possibly damaging Het
Other mutations in Smn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02377:Smn1 APN 13 100135684 unclassified probably benign
IGL02932:Smn1 APN 13 100127964 missense probably benign 0.40
IGL03325:Smn1 APN 13 100127857 missense probably damaging 1.00
R0907:Smn1 UTSW 13 100127896 missense probably damaging 0.99
R1573:Smn1 UTSW 13 100126610 missense probably damaging 1.00
R4898:Smn1 UTSW 13 100132423 missense probably damaging 1.00
R5082:Smn1 UTSW 13 100137382 splice site probably benign
R5902:Smn1 UTSW 13 100126904 missense probably benign 0.00
R6276:Smn1 UTSW 13 100127995 missense possibly damaging 0.66
R6481:Smn1 UTSW 13 100128500 unclassified probably null
R6758:Smn1 UTSW 13 100132438 missense possibly damaging 0.88
R7114:Smn1 UTSW 13 100131140 missense probably benign
R7378:Smn1 UTSW 13 100127865 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAGCCATTCATCAGGCCGGGAAAAG -3'
(R):5'- CTTCGTGCGTCAACGTGACAAC -3'

Sequencing Primer
(F):5'- GACTGGAATTACACTTGGAGAACTG -3'
(R):5'- CGTCAACGTGACAACTGATTC -3'
Posted On2014-04-24