Incidental Mutation 'R1629:Ppp2r2a'
ID172692
Institutional Source Beutler Lab
Gene Symbol Ppp2r2a
Ensembl Gene ENSMUSG00000022052
Gene Nameprotein phosphatase 2, regulatory subunit B, alpha
Synonyms2410004D02Rik
MMRRC Submission 039666-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1629 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location67014056-67072444 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 67019759 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 341 (C341S)
Ref Sequence ENSEMBL: ENSMUSP00000086640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089230] [ENSMUST00000225251] [ENSMUST00000225380]
Predicted Effect possibly damaging
Transcript: ENSMUST00000089230
AA Change: C341S

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000086640
Gene: ENSMUSG00000022052
AA Change: C341S

DomainStartEndE-ValueType
WD40 21 56 1.33e1 SMART
WD40 83 123 6.88e0 SMART
WD40 165 204 2.3e0 SMART
WD40 215 255 8.88e0 SMART
WD40 274 312 5.11e1 SMART
WD40 339 370 1.42e2 SMART
WD40 406 443 2.47e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223630
Predicted Effect probably benign
Transcript: ENSMUST00000225251
Predicted Effect possibly damaging
Transcript: ENSMUST00000225380
AA Change: C341S

PolyPhen 2 Score 0.737 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225469
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the phosphatase 2 regulatory subunit B family. Protein phosphatase 2 is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes an alpha isoform of the regulatory subunit B55 subfamily. Alternatively spliced transcript variants have been described. [provided by RefSeq, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 A C 18: 58,954,619 I574L probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
BC005624 T C 2: 30,974,008 E191G probably damaging Het
Cbx2 A G 11: 119,028,980 D457G probably damaging Het
Ccdc110 A G 8: 45,942,127 K352E probably benign Het
Cdk14 A T 5: 5,103,807 H183Q probably benign Het
Cfap58 A G 19: 47,941,339 T80A probably benign Het
Cftr C T 6: 18,226,106 T351I probably damaging Het
Col27a1 A G 4: 63,329,863 probably benign Het
Cp T A 3: 19,966,450 probably null Het
Cpne8 A T 15: 90,571,972 V196E probably benign Het
Dmxl1 T G 18: 49,859,286 probably null Het
Dnm2 T A 9: 21,504,458 L642Q probably damaging Het
Dock2 G T 11: 34,262,480 probably null Het
Dock9 A G 14: 121,543,574 F2091L possibly damaging Het
Eaf2 A G 16: 36,824,701 V53A probably damaging Het
Fam208b T C 13: 3,574,121 H1943R possibly damaging Het
Fbl G T 7: 28,174,787 probably benign Het
Fbn2 T C 18: 58,026,538 D2373G probably damaging Het
Gbp2b A G 3: 142,610,974 Y462C possibly damaging Het
Il1rl2 T A 1: 40,356,860 F348I probably benign Het
Khdc1a T A 1: 21,350,897 I102N possibly damaging Het
Klhl11 T C 11: 100,464,186 T270A probably benign Het
Lama1 T C 17: 67,805,428 S2288P probably benign Het
Lrfn4 T C 19: 4,613,495 E337G possibly damaging Het
Macf1 C A 4: 123,508,415 E549* probably null Het
Mmp3 G T 9: 7,447,641 V209F probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myh9 G A 15: 77,764,401 R1725W probably damaging Het
Nbea A T 3: 56,002,891 D1294E possibly damaging Het
Nrcam G A 12: 44,563,986 A496T probably benign Het
Nufip2 A G 11: 77,693,008 T583A probably benign Het
Olfr1033 A G 2: 86,041,422 T36A probably damaging Het
Ppig C A 2: 69,735,873 T128K probably damaging Het
Ptpre A T 7: 135,669,799 D374V probably damaging Het
Ranbp3l A C 15: 9,064,988 Q485P probably damaging Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Slc1a7 A G 4: 108,008,143 Y276C probably damaging Het
Smarcad1 A G 6: 65,067,107 D221G probably benign Het
Smn1 C A 13: 100,127,896 T45N probably damaging Het
Son T C 16: 91,657,622 S1086P probably damaging Het
Ssmem1 T A 6: 30,512,492 Y45N possibly damaging Het
Tmem184c A C 8: 77,602,922 F170V possibly damaging Het
Tmem184c A T 8: 77,606,162 probably null Het
Vmn1r59 C T 7: 5,454,467 C98Y probably damaging Het
Vmn2r23 T A 6: 123,713,427 S421T probably benign Het
Vmn2r98 T C 17: 19,067,383 S493P possibly damaging Het
Other mutations in Ppp2r2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01620:Ppp2r2a APN 14 67070277 missense probably damaging 0.96
IGL01997:Ppp2r2a APN 14 67016519 missense probably benign
IGL02024:Ppp2r2a APN 14 67038912 missense probably benign 0.06
IGL02178:Ppp2r2a APN 14 67023097 missense probably damaging 1.00
IGL03148:Ppp2r2a APN 14 67022295 missense probably benign 0.00
IGL03304:Ppp2r2a APN 14 67016528 missense probably benign 0.13
limber UTSW 14 67019804 missense probably damaging 1.00
R1216:Ppp2r2a UTSW 14 67028998 nonsense probably null
R1576:Ppp2r2a UTSW 14 67038869 splice site probably benign
R1662:Ppp2r2a UTSW 14 67016603 missense probably benign
R1808:Ppp2r2a UTSW 14 67038963 missense probably damaging 1.00
R1937:Ppp2r2a UTSW 14 67016429 missense possibly damaging 0.93
R2121:Ppp2r2a UTSW 14 67023128 missense probably damaging 1.00
R2134:Ppp2r2a UTSW 14 67016475 missense possibly damaging 0.63
R3150:Ppp2r2a UTSW 14 67023765 missense probably damaging 1.00
R3694:Ppp2r2a UTSW 14 67019750 missense probably damaging 1.00
R3695:Ppp2r2a UTSW 14 67019750 missense probably damaging 1.00
R3825:Ppp2r2a UTSW 14 67022443 missense probably damaging 0.98
R4031:Ppp2r2a UTSW 14 67028976 missense probably damaging 1.00
R4209:Ppp2r2a UTSW 14 67028879 missense probably damaging 1.00
R4353:Ppp2r2a UTSW 14 67028937 missense probably damaging 1.00
R4639:Ppp2r2a UTSW 14 67038957 missense probably damaging 1.00
R4976:Ppp2r2a UTSW 14 67016637 missense possibly damaging 0.71
R5001:Ppp2r2a UTSW 14 67022308 nonsense probably null
R5106:Ppp2r2a UTSW 14 67023097 missense probably damaging 1.00
R5322:Ppp2r2a UTSW 14 67038873 critical splice donor site probably null
R5360:Ppp2r2a UTSW 14 67016571 nonsense probably null
R5429:Ppp2r2a UTSW 14 67023756 missense probably damaging 1.00
R5439:Ppp2r2a UTSW 14 67022323 missense possibly damaging 0.70
R6250:Ppp2r2a UTSW 14 67038954 missense probably damaging 1.00
R6582:Ppp2r2a UTSW 14 67019804 missense probably damaging 1.00
R8263:Ppp2r2a UTSW 14 67023756 missense probably damaging 1.00
R8315:Ppp2r2a UTSW 14 67023728 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATCAAGTATCTGCACACTCGGC -3'
(R):5'- GCACTGCAATACCCAGAAAGGTGG -3'

Sequencing Primer
(F):5'- gctgaaacaatcctcctgcc -3'
(R):5'- ATACCCAGAAAGGTGGGTTTTCTTAG -3'
Posted On2014-04-24