Incidental Mutation 'R1629:Cpne8'
ID172696
Institutional Source Beutler Lab
Gene Symbol Cpne8
Ensembl Gene ENSMUSG00000052560
Gene Namecopine VIII
Synonyms1200003E11Rik, 1500031E20Rik
MMRRC Submission 039666-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R1629 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location90487482-90679432 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 90571972 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 196 (V196E)
Ref Sequence ENSEMBL: ENSMUSP00000067774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064391] [ENSMUST00000088649]
Predicted Effect probably benign
Transcript: ENSMUST00000064391
AA Change: V196E

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000067774
Gene: ENSMUSG00000052560
AA Change: V196E

DomainStartEndE-ValueType
C2 37 145 9.76e-10 SMART
C2 170 277 1.06e-10 SMART
low complexity region 284 291 N/A INTRINSIC
VWA 320 518 1.34e-9 SMART
low complexity region 559 569 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088649
SMART Domains Protein: ENSMUSP00000086024
Gene: ENSMUSG00000052560

DomainStartEndE-ValueType
C2 37 139 8.78e-3 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the copine family of highly conserved, calcium-dependent phospholipid binding proteins. The encoded protein has two characteristic C2 domains and a VWFA domain and may play a role in membrane trafficking. A related pseudogene is found on chromosome 8. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 A C 18: 58,954,619 I574L probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
BC005624 T C 2: 30,974,008 E191G probably damaging Het
Cbx2 A G 11: 119,028,980 D457G probably damaging Het
Ccdc110 A G 8: 45,942,127 K352E probably benign Het
Cdk14 A T 5: 5,103,807 H183Q probably benign Het
Cfap58 A G 19: 47,941,339 T80A probably benign Het
Cftr C T 6: 18,226,106 T351I probably damaging Het
Col27a1 A G 4: 63,329,863 probably benign Het
Cp T A 3: 19,966,450 probably null Het
Dmxl1 T G 18: 49,859,286 probably null Het
Dnm2 T A 9: 21,504,458 L642Q probably damaging Het
Dock2 G T 11: 34,262,480 probably null Het
Dock9 A G 14: 121,543,574 F2091L possibly damaging Het
Eaf2 A G 16: 36,824,701 V53A probably damaging Het
Fam208b T C 13: 3,574,121 H1943R possibly damaging Het
Fbl G T 7: 28,174,787 probably benign Het
Fbn2 T C 18: 58,026,538 D2373G probably damaging Het
Gbp2b A G 3: 142,610,974 Y462C possibly damaging Het
Il1rl2 T A 1: 40,356,860 F348I probably benign Het
Khdc1a T A 1: 21,350,897 I102N possibly damaging Het
Klhl11 T C 11: 100,464,186 T270A probably benign Het
Lama1 T C 17: 67,805,428 S2288P probably benign Het
Lrfn4 T C 19: 4,613,495 E337G possibly damaging Het
Macf1 C A 4: 123,508,415 E549* probably null Het
Mmp3 G T 9: 7,447,641 V209F probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myh9 G A 15: 77,764,401 R1725W probably damaging Het
Nbea A T 3: 56,002,891 D1294E possibly damaging Het
Nrcam G A 12: 44,563,986 A496T probably benign Het
Nufip2 A G 11: 77,693,008 T583A probably benign Het
Olfr1033 A G 2: 86,041,422 T36A probably damaging Het
Ppig C A 2: 69,735,873 T128K probably damaging Het
Ppp2r2a A T 14: 67,019,759 C341S possibly damaging Het
Ptpre A T 7: 135,669,799 D374V probably damaging Het
Ranbp3l A C 15: 9,064,988 Q485P probably damaging Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Slc1a7 A G 4: 108,008,143 Y276C probably damaging Het
Smarcad1 A G 6: 65,067,107 D221G probably benign Het
Smn1 C A 13: 100,127,896 T45N probably damaging Het
Son T C 16: 91,657,622 S1086P probably damaging Het
Ssmem1 T A 6: 30,512,492 Y45N possibly damaging Het
Tmem184c A C 8: 77,602,922 F170V possibly damaging Het
Tmem184c A T 8: 77,606,162 probably null Het
Vmn1r59 C T 7: 5,454,467 C98Y probably damaging Het
Vmn2r23 T A 6: 123,713,427 S421T probably benign Het
Vmn2r98 T C 17: 19,067,383 S493P possibly damaging Het
Other mutations in Cpne8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Cpne8 APN 15 90497058 splice site probably benign
IGL00545:Cpne8 APN 15 90540259 missense probably benign
IGL00951:Cpne8 APN 15 90601893 intron probably benign
IGL01069:Cpne8 APN 15 90615110 critical splice donor site probably null
IGL01294:Cpne8 APN 15 90501445 missense probably damaging 0.96
IGL01720:Cpne8 APN 15 90501500 missense probably benign 0.01
IGL01843:Cpne8 APN 15 90569497 missense probably benign 0.17
PIT4431001:Cpne8 UTSW 15 90551975 missense probably damaging 0.98
R0016:Cpne8 UTSW 15 90501405 splice site probably benign
R0016:Cpne8 UTSW 15 90501405 splice site probably benign
R0032:Cpne8 UTSW 15 90569568 splice site probably benign
R0032:Cpne8 UTSW 15 90569568 splice site probably benign
R0096:Cpne8 UTSW 15 90499915 missense probably benign 0.24
R0545:Cpne8 UTSW 15 90497075 missense probably damaging 1.00
R0637:Cpne8 UTSW 15 90648621 missense probably damaging 1.00
R0834:Cpne8 UTSW 15 90540259 missense probably benign
R0894:Cpne8 UTSW 15 90649271 missense probably damaging 0.97
R1568:Cpne8 UTSW 15 90619642 missense probably damaging 0.98
R1747:Cpne8 UTSW 15 90584915 missense probably benign 0.00
R1761:Cpne8 UTSW 15 90648618 missense probably damaging 1.00
R1884:Cpne8 UTSW 15 90648628 splice site probably benign
R2357:Cpne8 UTSW 15 90619674 missense probably damaging 0.99
R2434:Cpne8 UTSW 15 90509511 missense probably benign 0.07
R4043:Cpne8 UTSW 15 90572001 missense probably damaging 1.00
R4875:Cpne8 UTSW 15 90648568 splice site probably benign
R4969:Cpne8 UTSW 15 90619726 missense probably damaging 1.00
R4981:Cpne8 UTSW 15 90679235 missense probably benign 0.05
R5086:Cpne8 UTSW 15 90648568 splice site probably benign
R5154:Cpne8 UTSW 15 90499918 missense probably benign 0.10
R5199:Cpne8 UTSW 15 90648609 missense probably benign 0.10
R5424:Cpne8 UTSW 15 90516057 missense probably benign 0.00
R5528:Cpne8 UTSW 15 90619690 missense possibly damaging 0.95
R5946:Cpne8 UTSW 15 90488988 makesense probably null
R6158:Cpne8 UTSW 15 90571988 missense probably damaging 1.00
R6977:Cpne8 UTSW 15 90497091 missense probably benign 0.10
R7486:Cpne8 UTSW 15 90515906 critical splice donor site probably null
R7522:Cpne8 UTSW 15 90601819 missense probably benign 0.09
R7684:Cpne8 UTSW 15 90649247 missense probably damaging 1.00
R7726:Cpne8 UTSW 15 90501418 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCACTGAGGTATAGACCCCAAGGC -3'
(R):5'- CACCGGCATCCAAGTAACAAATGTG -3'

Sequencing Primer
(F):5'- GGAGAGAATGATCAATGTCTTCCC -3'
(R):5'- TGTTTTCTTGTCAAATCTTGTTTGTG -3'
Posted On2014-04-24